ID: 945437975

View in Genome Browser
Species Human (GRCh38)
Location 2:209841281-209841303
Sequence TTTCTAATCTCACTAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945437974_945437975 16 Left 945437974 2:209841242-209841264 CCTTTTATGTGTACAAATTATTT 0: 1
1: 1
2: 5
3: 60
4: 669
Right 945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG 0: 1
1: 0
2: 2
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945437975 Original CRISPR TTTCTAATCTCACTAAAACC AGG Intronic
902101450 1:13993351-13993373 CTTCCATTCTTACTAAAACCTGG - Intergenic
903745418 1:25583487-25583509 TTTTTAATCCCAAAAAAACCTGG - Intergenic
904872887 1:33632603-33632625 GTTTTATTCTCACAAAAACCAGG - Intronic
907897427 1:58704892-58704914 TTTCTTATCTACCTAAGACCTGG + Intergenic
908009321 1:59759448-59759470 TTTCTAATTTCACAAAAAGAGGG - Intronic
908559499 1:65291627-65291649 TTTCTACACCCAGTAAAACCTGG - Intronic
908692511 1:66798383-66798405 TGTCTAATCTCTCTGAAACCAGG - Intronic
910400637 1:86834621-86834643 ATTCTAAACTCTCTAAAGCCTGG - Intergenic
912403167 1:109413298-109413320 TTTCTAATATCATTAATACTTGG - Intronic
915366107 1:155317330-155317352 TTCCTAATCTCCCTGACACCAGG + Intronic
915921209 1:159977078-159977100 TTCCTAATCTCACCACAGCCTGG + Intergenic
916247683 1:162705202-162705224 TATCCAATCTCACTACAGCCAGG + Intronic
916647777 1:166803798-166803820 TTGCAAATCTCTTTAAAACCTGG + Intergenic
917216812 1:172687556-172687578 TTTATAATCTCAGTGAAGCCAGG + Intergenic
918599528 1:186339536-186339558 TTTCCATTCTTTCTAAAACCAGG + Intronic
919148401 1:193663914-193663936 TCTCTAATCTCACTAAGCCAAGG - Intergenic
920804872 1:209223534-209223556 TTCCTATTCTTACTAAACCCAGG - Intergenic
921130816 1:212218080-212218102 TTTCTAAGCACACTAGAAGCTGG - Intergenic
1064231579 10:13533634-13533656 ATTCTAATTTCACTAAAAAATGG - Intergenic
1065132339 10:22634903-22634925 TTTCCAATTTCTATAAAACCTGG + Intronic
1065905119 10:30243962-30243984 TTTCTAATATAAGTAAAAACTGG - Intergenic
1066028654 10:31393629-31393651 TTTTTAATGTCACGAAAACCAGG - Intronic
1071353313 10:84768023-84768045 TCTCTAATCTCGTTGAAACCTGG - Intergenic
1077703844 11:4465529-4465551 TTGCTAATCTCCCTAACAACAGG + Intergenic
1078319024 11:10317488-10317510 TTTCTTCTCTCAACAAAACCTGG - Intronic
1086017805 11:82188094-82188116 TTTCTAGTCTTTCTAAAACTTGG + Intergenic
1086328025 11:85724587-85724609 TTTCTTCTCTCACTGACACCTGG + Intronic
1088350950 11:108886850-108886872 TTGCTAATCTCATTCAAAACTGG + Intronic
1089094607 11:115909183-115909205 TTTTTAATCTCAATAACATCAGG - Intergenic
1091808616 12:3376466-3376488 TGTCTAATCTCATTACAATCAGG + Intergenic
1093708973 12:22307577-22307599 GTGCTGATGTCACTAAAACCAGG - Intronic
1094244246 12:28269404-28269426 TTTCTAAGTTCATTCAAACCAGG + Intronic
1095633276 12:44402377-44402399 TTAACAATCCCACTAAAACCTGG - Intergenic
1095646339 12:44552569-44552591 TTTCTTTTCCCCCTAAAACCTGG - Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098424978 12:70353036-70353058 ATTCTAACCTCATTAAAATCTGG - Intronic
1099305424 12:80948713-80948735 TTTCTTATATCACTAAATCCAGG - Intronic
1099350986 12:81568039-81568061 TTCCTAATCTGACTAACACTAGG + Intronic
1099537952 12:83868228-83868250 TTTTTATTCTGATTAAAACCTGG + Intergenic
1100379400 12:94047570-94047592 TTGCTAATCTCATTGAAGCCAGG - Intergenic
1101699577 12:107159865-107159887 GTTCTCACCCCACTAAAACCTGG + Intergenic
1102893824 12:116582518-116582540 TTTCTAACCTCTGGAAAACCAGG - Intergenic
1106943114 13:34798870-34798892 ATTCTAATTTCACTAAAATTGGG - Intergenic
1107081504 13:36379655-36379677 TTTCTAGGCCCACTAAAACAAGG + Intergenic
1108316817 13:49244578-49244600 TTTCTTATCTACCTAAGACCTGG + Intergenic
1108396200 13:49994463-49994485 CCTCTTATCTCCCTAAAACCTGG - Intergenic
1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG + Intergenic
1110158599 13:72348787-72348809 TTTTTAATCTCACAAAATTCTGG + Intergenic
1111354735 13:87083502-87083524 TCTCTGATATCACTTAAACCTGG + Intergenic
1111700920 13:91687502-91687524 TGTGTTATCTCACTAAAAACTGG - Intronic
1111745793 13:92267544-92267566 TTCCAAATCTTAGTAAAACCTGG + Intronic
1112895144 13:104289667-104289689 TTTCTAAACTCCATATAACCAGG - Intergenic
1113002534 13:105659014-105659036 TTTCAGATCTGACTGAAACCAGG - Intergenic
1115575175 14:34703978-34704000 TTTAAAATCTCAATATAACCAGG + Intergenic
1116093919 14:40343118-40343140 TTTTTAATATTACTAAAACTCGG - Intergenic
1116666613 14:47784166-47784188 TTACTCATCTCACAAAAATCAGG - Intergenic
1118355215 14:65008184-65008206 TTTCTAAACTCACTAAAGCCAGG - Intronic
1124495602 15:30185052-30185074 TTCCAAGTCTCACTAAAACATGG + Intergenic
1124747971 15:32353594-32353616 TTCCAAGTCTCACTAAAACATGG - Intergenic
1124799007 15:32811252-32811274 CTTCTAATTTCACCACAACCAGG - Intronic
1126274293 15:46858173-46858195 TTTCTGTTCTCACTACGACCAGG + Intergenic
1130507893 15:84563391-84563413 CTTCTCAGCTCACTGAAACCTGG - Intergenic
1130677404 15:85965484-85965506 TTTCTTTTCTCCCTACAACCAGG + Intergenic
1134487196 16:14667918-14667940 TTTCTACCCTCAGTAAAACAAGG + Exonic
1134802734 16:17100313-17100335 TTTCTACTCTCACTTCACCCAGG + Intergenic
1135429437 16:22370761-22370783 TTTCTAACCTCAGTAAACTCTGG - Intronic
1139373597 16:66483312-66483334 TTTTTAACCTCACTGAAACTTGG + Intronic
1139439277 16:66957067-66957089 TTTCTATCTTCACTAAAACTTGG + Intergenic
1140635171 16:76903934-76903956 TTTCTGATTTCCCTGAAACCAGG - Intergenic
1140655497 16:77135207-77135229 TTTCTAAAATCCCTAAAACCAGG - Intergenic
1144428213 17:15165384-15165406 TTTTTAATCCCACTAACACAGGG - Intergenic
1148729513 17:49823962-49823984 TTCCTAATCTCAGGAATACCTGG + Intronic
1149953928 17:61023810-61023832 TTTCAAATCTCAGGAAAATCTGG - Intronic
1150570696 17:66384373-66384395 TTTGGAAACTCATTAAAACCAGG + Intronic
1151479930 17:74364063-74364085 TTTCTAATCTCCCTTATCCCTGG + Intergenic
1152056913 17:78036235-78036257 TCGCTAAGCACACTAAAACCTGG - Intronic
1155299753 18:24418517-24418539 TCTCTAATTTGACTAAAATCTGG + Intergenic
1156013813 18:32525331-32525353 TTTCTAATTTAACTAAAAAGTGG + Intergenic
1156519335 18:37708391-37708413 TGTCTAATTTCATAAAAACCTGG - Intergenic
1158863013 18:61611481-61611503 TTCCTTATCTGACTAAAAGCAGG - Intergenic
1159753604 18:72335011-72335033 TTTCTCATTTCACTCAAAACAGG + Intergenic
1162214969 19:9126617-9126639 TTTCCAATCCAACAAAAACCAGG + Exonic
926415820 2:12649005-12649027 TTTCTAATCCCACTGCATCCTGG - Intergenic
928635858 2:33245946-33245968 TCTATAATCTTATTAAAACCTGG - Intronic
928664804 2:33539640-33539662 TTTCTAATCTCAGTAACATCGGG - Intronic
929803780 2:45127157-45127179 TGTGTAATATCACTAAAAGCAGG + Intergenic
929996352 2:46828569-46828591 TTTATCATCACAATAAAACCTGG + Intronic
930196955 2:48519821-48519843 TTCCTTGTCTCACTAAAAACAGG - Intergenic
932009027 2:67956845-67956867 TTTCTAATCTACATAAAACAAGG - Intergenic
932054274 2:68428965-68428987 TTTCTTCTCGCAATAAAACCTGG + Intergenic
932598065 2:73106593-73106615 GTCCCCATCTCACTAAAACCTGG + Intronic
933507135 2:83191810-83191832 TTTCTAATCTCTTTCTAACCTGG + Intergenic
934918139 2:98317634-98317656 TTTCAAATCTACCTATAACCTGG + Intergenic
936693375 2:114919114-114919136 TTCCTCATCTCAATAAAACTTGG - Intronic
936963532 2:118102210-118102232 ATTCTAATCTTCCTAAAAACAGG - Intronic
937404359 2:121612809-121612831 TTCATAATCTCACTAAAGGCAGG - Intronic
937504224 2:122518252-122518274 TTTCAGATCTCACAAAAACTGGG - Intergenic
938794932 2:134710001-134710023 TTTTTAATCTACCTATAACCTGG + Intronic
939818208 2:146922538-146922560 TTTGTAATTTCAGTAAAAACAGG + Intergenic
941135367 2:161710875-161710897 TTTCTAATCTCCTTGAAAGCAGG - Intronic
941514161 2:166450913-166450935 TTTTTAATCTCACGAAAATTTGG - Intronic
941610891 2:167660837-167660859 TTTTTAATCTCTCTGAAACAAGG - Intergenic
943820990 2:192320656-192320678 TTTGTACTCTCACTAACACTTGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945419095 2:209612934-209612956 TTTGAAATAACACTAAAACCAGG - Intronic
945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG + Intronic
945828014 2:214748394-214748416 TATCTAATCTCTATAAAATCAGG - Intronic
946667063 2:222061835-222061857 TTTCTCATTTCCCTATAACCTGG - Intergenic
947192572 2:227523008-227523030 TTTATAATTTCACAAAAACTGGG - Intronic
1169956294 20:11106702-11106724 TTTATAATATTTCTAAAACCTGG + Intergenic
1171350633 20:24499994-24500016 TTTCACTTCTCACTAAATCCGGG - Intronic
1171969330 20:31553886-31553908 TTTCCCATCTCACTATAACAGGG - Intronic
1172835438 20:37870224-37870246 TTCCTGGTCTCACTGAAACCTGG + Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178170004 21:30030031-30030053 TACATAATCTTACTAAAACCAGG + Intergenic
1178667293 21:34559711-34559733 TTTCAAGTTTCTCTAAAACCTGG + Intronic
1179086769 21:38225319-38225341 TTTCTAATCCCTTTAAAACAAGG - Intronic
952053376 3:29413634-29413656 TTTCTAATCTTACTTAACCCTGG - Intronic
952504047 3:33991380-33991402 TTTCAAATCTCATTAATAACTGG - Intergenic
952597076 3:35030808-35030830 TTTCTAATTTCTCTATATCCTGG + Intergenic
953747833 3:45588489-45588511 TTTTTAATCTACCTATAACCTGG - Intronic
953757318 3:45657926-45657948 TTTCTACGCTCACTGAAACCTGG + Intronic
955445155 3:59001749-59001771 TTTCTAATCTCGCAAAAGCAGGG + Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
956860340 3:73317072-73317094 TTTCTCATCTCACCAGAAACTGG - Intergenic
957500414 3:81050089-81050111 TGTCTAATCTCACTTATATCTGG - Intergenic
957790271 3:84931641-84931663 TTTCTAATCCCATTAAAAATTGG - Intergenic
958735575 3:98005564-98005586 TTTAGAATCTCTCTAAAGCCAGG - Intronic
959551176 3:107659798-107659820 TTTCTAGTCTCACTAAACCCAGG - Intronic
960308095 3:116087219-116087241 TTTCTAGTCACACTAAATGCAGG + Intronic
963373068 3:144426884-144426906 TTTTTCATCTCACTGAAACATGG + Intergenic
967357288 3:188586442-188586464 TTTCTAATATCAATTAAACATGG - Intronic
967823553 3:193860607-193860629 TCTCTATACTCACCAAAACCTGG - Intergenic
967842498 3:194018141-194018163 TTTCTGAGCACACTTAAACCTGG - Intergenic
969023092 4:4151229-4151251 TTTCTAGTCTCAATAAACCAGGG - Intergenic
969385613 4:6844857-6844879 TTTCTATTCTTCCTTAAACCAGG - Intronic
971122171 4:23716886-23716908 TTTCTAATCGCAGTAACACCTGG + Intergenic
972241349 4:37196261-37196283 TGTCTAATATCCCAAAAACCGGG + Intergenic
972510880 4:39768131-39768153 TTTCTAGTCTCACAATAACAAGG - Intronic
975063584 4:70035857-70035879 TTTCTAATATCACGAAGAGCAGG - Intronic
975286246 4:72624445-72624467 TTTCCAATCCCATTAAAAACTGG - Intergenic
975349854 4:73333133-73333155 TTATTAATGTCACCAAAACCAGG + Intergenic
975356886 4:73417241-73417263 TTTCTTCTTTCAATAAAACCTGG - Intronic
975521689 4:75308309-75308331 ATTCTAATGTCACTGAAACCAGG + Intergenic
975658290 4:76663307-76663329 TTTGAAATCTCACTCAACCCGGG + Intronic
975758534 4:77595328-77595350 TTTCTAAACTCAATACATCCTGG - Intronic
976442058 4:85087205-85087227 TTTTTAATCTACCTATAACCTGG - Intergenic
977078767 4:92494760-92494782 TTTCTAATTTTACTAAAAAAGGG + Intronic
977706983 4:100082618-100082640 TTTCATATCTCTCTAAATCCAGG - Intergenic
978093770 4:104750106-104750128 TTTCTAATCTAAAAACAACCAGG + Intergenic
980695226 4:136346081-136346103 TTTCTAATAGCATTAAAACATGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982296372 4:153833640-153833662 TTCCTAATCTCCCTTGAACCAGG - Intergenic
982523600 4:156450724-156450746 TTTCTCATCTCATTACAACTGGG + Intergenic
984653346 4:182291958-182291980 TTTGTAATCTTATTAAAACTTGG + Intronic
984786592 4:183572958-183572980 TTTTTAACCTCGCTAAACCCAGG - Intergenic
985793398 5:1944986-1945008 TTTCTCATCTCTGGAAAACCAGG + Intergenic
986895703 5:12364313-12364335 TCTAAAATCTCAGTAAAACCAGG + Intergenic
987026773 5:13934904-13934926 TTTCAAATGTCACTAAAGCCAGG + Intronic
987334254 5:16885035-16885057 TTTCTGGTATCATTAAAACCGGG + Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987807954 5:22794608-22794630 TTTCTATTCTCTCTAAATCTTGG - Intronic
987985446 5:25140296-25140318 TTTCTAATTTGGCTAAAATCAGG - Intergenic
988545000 5:32147537-32147559 CTTCTAATCTCCCTAAAAAATGG - Intronic
989626138 5:43431115-43431137 TTTCTAAAGTCACTATGACCTGG - Intergenic
992503779 5:77366172-77366194 TTTCTAATTTCAATTAAAGCAGG - Intronic
993297598 5:86162086-86162108 TTAATAGTTTCACTAAAACCTGG - Intergenic
993850181 5:92998856-92998878 TTTATACTCACACTCAAACCAGG + Intergenic
994061927 5:95487409-95487431 TGTCTAAACCCACTAACACCAGG + Intronic
994166942 5:96618328-96618350 TGTCACATCTCACTAAGACCAGG - Intronic
999036033 5:148350762-148350784 TTTCAAATCTCACCTAAACTTGG - Intergenic
1000736862 5:164914233-164914255 TTTCTAACCTCAACATAACCAGG + Intergenic
1000983208 5:167839215-167839237 TTTCTATTCTCATGAAAAGCAGG - Intronic
1001905479 5:175469072-175469094 TTTCATATCTCACCAAGACCTGG - Intergenic
1001973644 5:175978808-175978830 TTTTTAATCTACCTATAACCTGG + Intronic
1002243788 5:177864971-177864993 TTTTTAATCTACCTATAACCTGG - Intergenic
1002358760 5:178652971-178652993 TTCCTCATCACACTGAAACCAGG + Intergenic
1002553232 5:180013863-180013885 TTTCTAATCTCACTGAGACAGGG + Intronic
1002973527 6:2050066-2050088 TTTAAAAAATCACTAAAACCAGG + Intronic
1003034638 6:2632316-2632338 TTTCTAATGTCTCTAAGACGTGG + Intronic
1004521704 6:16366891-16366913 TTTCATAGCTCATTAAAACCAGG - Intronic
1007310079 6:40938354-40938376 TTTCTCATCTCAAAAATACCAGG - Intergenic
1008647921 6:53534106-53534128 TTTCTAAGCTCACACAACCCGGG + Intronic
1010487384 6:76431840-76431862 TTTCTAATCTCCCTGAGGCCTGG - Intergenic
1011152824 6:84292660-84292682 TTTCCTATCTAACTAAAATCTGG - Intergenic
1014015856 6:116529207-116529229 TTGCAAATCTCACTAGACCCTGG + Intronic
1015087904 6:129318014-129318036 TTCCTAATCTCAGTAAAAACTGG + Intronic
1016925641 6:149344323-149344345 TCTGTAAGCTCACTAAAACAAGG - Intronic
1029328862 7:99834453-99834475 TTTCTAATTCCTCTAAAGCCAGG - Intronic
1029918463 7:104236745-104236767 TTTTTGAACTAACTAAAACCTGG - Intergenic
1030609256 7:111670853-111670875 TGTCTAATATCACAAAAACCTGG + Intergenic
1031710621 7:125041859-125041881 TGCCTAATTTCACTAAATCCAGG - Intergenic
1032899434 7:136290279-136290301 TTTCTCACCTCTCTAGAACCAGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036442737 8:8795837-8795859 TTTCCAAGCTCCCTAAAAACAGG + Intronic
1036493405 8:9248569-9248591 TTCCTAAACCCAGTAAAACCAGG - Intergenic
1038193336 8:25343978-25344000 TTTGTAATCTTAGTAAAGCCAGG + Intronic
1039749333 8:40462737-40462759 TTTCTAACCTCATCAAAAGCTGG - Intergenic
1039917173 8:41868695-41868717 TTACAAAGCTCACTAAAGCCTGG + Intronic
1040698487 8:50032883-50032905 TTTCTAAACTCACAATAATCTGG + Intronic
1042520030 8:69701620-69701642 TTTTTAATCTACCTAAAAGCTGG + Intronic
1043914299 8:85903084-85903106 TTTCTGAGCTCAGAAAAACCAGG + Intergenic
1044176191 8:89126341-89126363 TTTATAATTTCACTTATACCTGG + Intergenic
1046327595 8:112670478-112670500 TAACTGATCTCACTAAATCCAGG - Intronic
1048082200 8:131140476-131140498 TTTCCAATCTCCATAATACCTGG + Intergenic
1049467620 8:142759352-142759374 TTTTAAATCTACCTAAAACCTGG + Intergenic
1049921572 9:369687-369709 TTTCTAATCTCACAAACATGTGG + Intronic
1050065696 9:1757452-1757474 TTTCTACTCTCTCTAAACACAGG + Intergenic
1055170073 9:73246259-73246281 TTACCAATCTCAATAACACCTGG - Intergenic
1055325177 9:75121168-75121190 ATTTAATTCTCACTAAAACCTGG - Intronic
1055710931 9:79061427-79061449 TTTCTAATCATTCTAAAATCAGG + Intergenic
1056407145 9:86285273-86285295 TTTCTAATATCACTTGAAACTGG + Intergenic
1058753472 9:108062797-108062819 TATCTAAACTCTCTAAAACTAGG - Intergenic
1058863583 9:109140959-109140981 TTCTTAATCTCTCTAAAATCAGG + Intronic
1059639406 9:116202050-116202072 TTTCTATTCCCACTCAAAGCAGG - Intronic
1060911461 9:127354468-127354490 TTTTTATTTTCAGTAAAACCTGG - Intronic
1060926045 9:127456011-127456033 TTTCTATTATTACTAACACCGGG - Intronic
1061155260 9:128856720-128856742 TCTCTAATCTCAATAAACCAGGG + Intronic
1186081292 X:5936271-5936293 TTTCTAATCCTACGAAACCCAGG + Intronic
1188287908 X:28351134-28351156 TTCATAATCTCACTAACACACGG - Intergenic
1190843838 X:54172569-54172591 TTTCTCATCACACAAAATCCAGG + Intronic
1194090554 X:89579113-89579135 TTTCTAATCCCTCTAAAGCAAGG - Intergenic
1194671671 X:96741355-96741377 CTTCTAAACTCACTCCAACCAGG + Intronic
1196253350 X:113487158-113487180 CCTCTAATATCTCTAAAACCTGG + Intergenic
1196512223 X:116525173-116525195 TATTTAATATCACTAAAACTAGG + Intergenic
1197200590 X:123745278-123745300 CTTCAAATCTCACTCAAAACTGG + Intergenic
1200443209 Y:3235173-3235195 TTTCTAATCCCTCTAAAGCAAGG - Intergenic
1202071453 Y:20996036-20996058 TTTCTAATTCCTCTAAAACAAGG + Intergenic