ID: 945440154

View in Genome Browser
Species Human (GRCh38)
Location 2:209868736-209868758
Sequence TGTTCTCTGCATGGGTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945440154 Original CRISPR TGTTCTCTGCATGGGTTACA GGG (reversed) Intronic
900326794 1:2112143-2112165 TCACCTCTGCCTGGGTTACAGGG + Intronic
903246658 1:22020934-22020956 TGTTCTCTGCCTGGCCAACATGG + Intergenic
906743840 1:48207840-48207862 TGCTCTCTGCACTGGGTACAGGG - Intergenic
907629627 1:56067236-56067258 TGTTTTCTTCATGGGATTCAAGG - Intergenic
908625066 1:66031013-66031035 TGCTTTCTGCCTGGGTGACAGGG + Intronic
909323493 1:74319737-74319759 TGTTCCCTGCATGACTTCCAAGG - Intronic
909710474 1:78644068-78644090 TGTTTTCTCCCTGGATTACATGG - Exonic
911248451 1:95547154-95547176 TGTTTTCTCCTTGGGTGACATGG + Intergenic
911721304 1:101194148-101194170 TGCTCTCTACATGGACTACATGG + Intergenic
912209261 1:107540896-107540918 TGTTTTCATCATGGTTTACAGGG + Intergenic
916649253 1:166819675-166819697 TGTTCTCTGGATGTGAGACATGG - Intergenic
916832893 1:168511185-168511207 TCTTCACTGCATGGCTTGCAGGG + Intergenic
917960464 1:180140184-180140206 TGCACTCTGCCTGGGTGACAGGG + Intergenic
919636859 1:200011799-200011821 TGTACTCTGCCTGTGTGACAGGG - Intergenic
920059415 1:203217261-203217283 TGTTCTCTGCCTGGGGTATCTGG - Intronic
922009757 1:221571087-221571109 AGTTCTCCCCATGGGTCACAAGG - Intergenic
1063299423 10:4838216-4838238 TGTGCTCGGCAGGGGTTACAGGG - Intronic
1064963643 10:20993594-20993616 TGTTCTCACAATGGGTTGCAGGG + Intronic
1066288833 10:33995466-33995488 TTTTCTTTGCTTGGGTTACAGGG - Intergenic
1067099647 10:43325298-43325320 TGGTGTCTGCATGGGCTGCATGG + Intergenic
1068500398 10:57835706-57835728 TGTTATCAGTATGGTTTACAAGG + Intergenic
1071990359 10:91095450-91095472 TCCTTTCTGCATGGATTACAAGG - Intergenic
1072255645 10:93617877-93617899 TGTGATCTGCATGGATAACAGGG + Intronic
1073934853 10:108619107-108619129 TGCACTCTGCCTGGGTGACAAGG - Intergenic
1076058785 10:127396901-127396923 TGATCTGAGCATGAGTTACACGG + Intronic
1076058788 10:127396939-127396961 TGATCTGAGCATGAGTTACACGG + Intronic
1076058794 10:127397013-127397035 TGATCTGAGCATGAGTTACACGG + Intronic
1076058798 10:127397051-127397073 TGATCTGAGCATGAGTTACACGG + Intronic
1076058808 10:127397165-127397187 TGATCTGAGCATGAGTTACACGG + Intronic
1076058814 10:127397239-127397261 TGATCTGAGCATGAGTTACACGG + Intronic
1076058818 10:127397277-127397299 TGATCTGAGCATGAGTTACACGG + Intronic
1076058822 10:127397315-127397337 TGATCTGAGCATGAGTTACACGG + Intronic
1076058826 10:127397353-127397375 TGATCTGAGCATGAGTTACACGG + Intronic
1076058829 10:127397391-127397413 TGATCTGAGCATGAGTTACATGG + Intronic
1076058832 10:127397429-127397451 TGATCTGAGCATGAGTTACAAGG + Intronic
1076058835 10:127397467-127397489 TGATCTGAGCATGAGTTACACGG + Intronic
1076058838 10:127397505-127397527 TGATCTGAGCATGAGTTACACGG + Intronic
1076058842 10:127397543-127397565 TGATCTGAGCATGAGTTACATGG + Intronic
1076058845 10:127397581-127397603 TGATCTGAGCATGAGTTACACGG + Intronic
1076058848 10:127397619-127397641 TGATCTGAGCATGAGTTACACGG + Intronic
1076921735 10:133457853-133457875 TGATCTCTGCATGTCTAACATGG + Intergenic
1078388816 11:10917425-10917447 TGTTCTTTGGATGGGGAACATGG - Intergenic
1078397502 11:10994097-10994119 TATTGTCTGCATGGATTAAAAGG - Intergenic
1079942822 11:26703139-26703161 TTTTCTTTTCATGGGTTAAAAGG - Intronic
1081380524 11:42409043-42409065 TATTCTCTGCTTGGTTTCCATGG + Intergenic
1081513044 11:43795641-43795663 TGTTGTCTGCATGCGATGCATGG + Intronic
1082033432 11:47624333-47624355 TTTTCTCTGTATTGGTTAGAAGG - Intronic
1082911388 11:58379249-58379271 TGTTCACTACCTGGGTGACAGGG + Intergenic
1086472319 11:87128069-87128091 TATTCTCTGAAGTGGTTACACGG + Intronic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1087724974 11:101706271-101706293 TGTTCTGTGTATTGGTTACAGGG - Intronic
1089703494 11:120260132-120260154 TGTTCTCTCCATTGTTTACCAGG + Intronic
1090870451 11:130741153-130741175 TGTATTCTGCTTGGGTTTCATGG + Intergenic
1091920961 12:4304119-4304141 TTTTCTCTCCATGGGCCACAGGG + Exonic
1092198871 12:6567691-6567713 TCTTCTCTGTATGAGTTACTAGG - Intronic
1093182887 12:15987684-15987706 TGTTCTCCTGATTGGTTACATGG + Intronic
1097662487 12:62446008-62446030 AGTTCTCTGCATGGGTTGGGAGG + Intergenic
1098447614 12:70583055-70583077 TGTTCTCAGCATGTAGTACATGG - Intronic
1099860792 12:88222894-88222916 TGTGCCCTGCATGGGGGACATGG + Intergenic
1099980143 12:89590462-89590484 TTTTCTCTGCATCAGTTATAAGG + Exonic
1100050795 12:90446130-90446152 TGTTATCAGTATGGTTTACAGGG - Intergenic
1100458713 12:94777384-94777406 TGTTTGCTGTATGGGTTTCAGGG + Intergenic
1102723281 12:115035913-115035935 TTTTCTCAGCATGGGTCACTTGG + Intergenic
1103538737 12:121651639-121651661 TGTTCTCTGCAGGGGAGAGAGGG + Exonic
1103937707 12:124485316-124485338 TGTTCTCTTGTTGTGTTACAAGG - Intronic
1106125532 13:26897566-26897588 TGTTTTCTGCATGGCTGAGATGG + Intergenic
1107448462 13:40488273-40488295 TGGACCCTGCCTGGGTTACAGGG - Intergenic
1109077725 13:57859023-57859045 TGTTCTGTACATGGCTTAAAGGG - Intergenic
1111767424 13:92549451-92549473 TGTTCTCTCTATGGGTTTGAAGG + Intronic
1113945381 13:114041093-114041115 TCTTCTCTGCTTGTGTTGCAGGG - Exonic
1116091103 14:40307974-40307996 TGTTCTCTGGATGTGAGACATGG + Intergenic
1118525181 14:66632526-66632548 TGCACTCTGCCTGGGTGACAGGG - Intronic
1118679696 14:68227325-68227347 TGTTCTCTCCTTGGGGTCCAAGG + Intronic
1122533410 14:102445138-102445160 TGATCTCTGCATGGAGTCCATGG - Intronic
1124684029 15:31763403-31763425 TGTTCTTTAGATGGGTTAAATGG + Intronic
1126331045 15:47531850-47531872 TGTTCTTTGCATGTGTTGGAGGG + Intronic
1126528613 15:49687120-49687142 AGGTTTCTGCATGGATTACAAGG - Intergenic
1127735395 15:61834586-61834608 TGTTCCCTGAATGGGTTGAAGGG - Intergenic
1128944268 15:71810733-71810755 TCTGGTCTCCATGGGTTACAGGG - Exonic
1130805068 15:87312371-87312393 TGTTCTCTGGCTGGGTTATTTGG - Intergenic
1131308578 15:91267437-91267459 GGTTCTCTCCATGGGTTCCTAGG + Intronic
1139555650 16:67708070-67708092 TGTTTGGTGCTTGGGTTACATGG + Intronic
1140223738 16:73063090-73063112 TGGTCTCTGCACGGGATCCAAGG + Intergenic
1141895128 16:86954307-86954329 TTTTGCCTGCATGGGATACAAGG + Intergenic
1143131925 17:4684062-4684084 TTTTTTCTCCATGGGTTCCAGGG - Intronic
1144490300 17:15702895-15702917 TTTTCTCTCCATGGGTTTTATGG + Intronic
1146602718 17:34232732-34232754 TGTTATCTGCAGGAGTTACTGGG - Intergenic
1150849722 17:68693086-68693108 TGAGCTGTGGATGGGTTACAGGG + Intergenic
1153969710 18:10215220-10215242 TGATATTTACATGGGTTACAGGG + Intergenic
1156459475 18:37313662-37313684 TGTTGTCTGCAAGGGCTTCAAGG - Intronic
1157899893 18:51504785-51504807 TGAGCTCTGCATGGATTAAAGGG + Intergenic
1158001756 18:52627584-52627606 TGTTCTCTGCAGAGATAACATGG - Intronic
1159124147 18:64203371-64203393 TTTGCTCTGCATGGGTTAAGTGG - Intergenic
1159465493 18:68777579-68777601 TTTTCTTGGCATGGGTTAAAGGG + Intronic
1160194820 18:76744279-76744301 TTCTCTCTGCATTGATTACATGG + Intergenic
1160669081 19:348183-348205 TCTTCTCTGCCTGGTTTTCATGG + Intergenic
1162150394 19:8641011-8641033 TGTTCTCTGCAAGGTTTGCTTGG + Intergenic
1164807891 19:31130925-31130947 TGATCTCTGCTTTGGTTTCATGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926803924 2:16687058-16687080 AGTTCCCTGCATTGGTTAAATGG - Intergenic
927048648 2:19305119-19305141 TGCTTTCTGCTTTGGTTACAAGG - Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936243639 2:110808427-110808449 TGTTCTGTGCAGGGGTCTCAAGG - Intronic
937579388 2:123465266-123465288 TGTTATCTGCAGGGGTAACTGGG - Intergenic
939494273 2:142909445-142909467 TGTTCACTACTTGGGTAACAGGG - Intronic
939968259 2:148632140-148632162 TGTTCTTTGCACAGGTTACTTGG - Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
940649678 2:156429343-156429365 TGTTCTCTGCAAGAGTTTCTTGG + Intergenic
945283476 2:208059618-208059640 TGATCTCTGCATTGGAAACATGG - Intergenic
945440154 2:209868736-209868758 TGTTCTCTGCATGGGTTACAGGG - Intronic
947047542 2:226005302-226005324 TGTTCTCTACCTGGTCTACAAGG + Intergenic
948134797 2:235628435-235628457 TGTTCTTTGCATGGATTTCTGGG + Intronic
1169784937 20:9349557-9349579 TGTGCTCTTCATGGGGCACATGG + Intronic
1169957924 20:11126446-11126468 TGTATTCTGTTTGGGTTACAAGG - Intergenic
1170471168 20:16669708-16669730 TCTTCTCAGCATGGGACACATGG - Intergenic
1170634993 20:18096506-18096528 TTGTCTGTGCATTGGTTACATGG - Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1174229772 20:49036957-49036979 TGCTCTCAGCCTGGGCTACAGGG - Intergenic
1175681930 20:60995388-60995410 TGTTCTCTGCATGAGTCAGGAGG + Intergenic
1176123100 20:63462917-63462939 CGTTCTCTGCATGCGTGCCACGG - Intronic
1177135149 21:17299786-17299808 TGTTATCAGCGTGGGTTGCAAGG + Intergenic
1178577855 21:33811043-33811065 TTTTCTCTGCATAGTTTGCAGGG - Exonic
1179537216 21:42060420-42060442 TGCCCTCTGCATGGGTTCCTGGG + Intergenic
1180625249 22:17189923-17189945 TGTTCACAGCATGGGTTACCAGG + Exonic
1182792238 22:32962460-32962482 TGTTCTCTGCATGTATTTAATGG - Intronic
1183280025 22:36927110-36927132 TGCTCTTTGCAAGGGTCACACGG + Intronic
1185078392 22:48695654-48695676 GCTTCTCTTCATGGGTTTCATGG + Intronic
950547068 3:13644600-13644622 TGTTATCTGCAGTGGTTAAAAGG - Intergenic
951966586 3:28392517-28392539 TGTTCTGTGCATGTGTGAGAAGG - Intronic
953622854 3:44547914-44547936 TGTTATCAGCATGGTTTGCAAGG - Intergenic
953774663 3:45805714-45805736 TGATTTCTTCATGGATTACATGG + Intergenic
954703638 3:52466527-52466549 TGCACTCAGCATGGGTGACAGGG + Intronic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
955353555 3:58211594-58211616 GGGTCTCTCCATGGGTTTCACGG - Intronic
955809545 3:62772344-62772366 AGTTTTCTGCATCTGTTACATGG - Intronic
956004153 3:64761129-64761151 TGTTCTCTGAAGGGGAAACAAGG - Intergenic
960419561 3:117427159-117427181 TGCTCTCAGCATGGCTCACAGGG + Intergenic
961556610 3:127700551-127700573 TGTCCTCTGCATGGCCTGCACGG + Intronic
965019152 3:163203674-163203696 AGTTCTTAGCATGGCTTACAAGG - Intergenic
965266926 3:166555289-166555311 TGTTCACTGTTTGGGTGACAGGG - Intergenic
966154836 3:176904334-176904356 TGTACTCTGCATGGGACACAGGG + Intergenic
969422205 4:7103949-7103971 TTTTCTGTGCCTGGATTACATGG + Intergenic
975068945 4:70107985-70108007 TTTTCTCTGCATTGATTCCATGG + Intergenic
976708790 4:88046546-88046568 TGTTCTGTTCATGCATTACAAGG - Intronic
980396129 4:132217698-132217720 TGTTTTGGCCATGGGTTACACGG - Intergenic
984356583 4:178667142-178667164 TGTTCTCTGAATGGGTGTAATGG + Intergenic
985826502 5:2195539-2195561 TGGTCTCTGCATGGGTGATGAGG - Intergenic
987379542 5:17272265-17272287 TGTTATGCGCCTGGGTTACAAGG - Intronic
987381375 5:17289008-17289030 TGTCCTCTGCATGGCTTGCAAGG - Intergenic
988315299 5:29618720-29618742 TGTTCACTACCTGGGTGACAAGG + Intergenic
989223383 5:38995465-38995487 TGTACACTGCTTGGGTGACAGGG + Intronic
990904690 5:60791430-60791452 TGTTCACTATATGGGTGACAAGG + Intronic
991381521 5:66033005-66033027 TGTTCTATGCATGGCTAACTTGG - Intronic
992009801 5:72514897-72514919 GGATCTCTCCATGGGTTACCTGG - Intergenic
992407759 5:76475874-76475896 TGGCCTCTGCATGGGAAACAGGG + Intronic
993297956 5:86167807-86167829 TGTTCTCAGCCTGGGCAACATGG - Intergenic
994287171 5:97983055-97983077 TGTTCTCTCCTTGTGTTATAAGG - Intergenic
996629503 5:125610560-125610582 TGTTATCTGCATGTGGTACCTGG - Intergenic
996854346 5:127988217-127988239 TGTTCTATGAATTGGTTACTTGG - Intergenic
998111525 5:139506344-139506366 TGTTATCAGTATGGTTTACAAGG + Intergenic
998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG + Intergenic
999113053 5:149138530-149138552 TTTTCTCTGCATAGTTTATAAGG - Intergenic
999550738 5:152684545-152684567 TTATCTATGCTTGGGTTACATGG + Intergenic
1001321794 5:170688632-170688654 TGTTATCTGGAGGGGTGACATGG - Intronic
1002662009 5:180797615-180797637 TTTGCTCTGCATGGCTTAGAAGG - Intronic
1003828339 6:9977015-9977037 TGTTTTATCCATGGGTTACTAGG - Intronic
1004104846 6:12657341-12657363 TGTGCTCTGCTGGGGTTAAATGG + Intergenic
1007543274 6:42669810-42669832 TGTTCTCAGGATGGGAAACAGGG + Intronic
1008658469 6:53641246-53641268 TGTTGACAGCATGGGTTATAGGG + Intergenic
1009342267 6:62570604-62570626 TTTTCTCTGCATAGGATGCATGG + Intergenic
1013649223 6:112176981-112177003 TTTTCTCTGAATGGCTTACTAGG + Intronic
1017397448 6:154018734-154018756 CTTTCTCTGCATGGTTTATACGG + Intronic
1017749860 6:157481174-157481196 TGATCTCTCCATGTTTTACATGG - Intronic
1019014597 6:168870837-168870859 TGCTCTCTGCCTGGGCTACTGGG + Intergenic
1019411519 7:908827-908849 TGTCGTCTGCATTGGTGACACGG - Intronic
1021929187 7:25562529-25562551 TGTTCTCTGCAGTGGTTATGAGG + Intergenic
1022016817 7:26357360-26357382 TGTTCTCTGCCTGGATTGCTAGG - Intronic
1023081714 7:36532727-36532749 TGCTCCCTGCATGGGGCACAGGG + Intronic
1023832751 7:44049510-44049532 TTATCTCTCCATGGGTGACATGG - Intronic
1026545476 7:71318241-71318263 TTTCATCTGCATGGGTCACAGGG + Intronic
1028394227 7:90349510-90349532 TTTTCTCTGGATTGGTTCCATGG - Intronic
1030184875 7:106751682-106751704 TGTTCTCTCTTTGGGTGACAGGG - Intergenic
1032785968 7:135199671-135199693 CGTGCTCTACATGGGTCACAGGG + Intronic
1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG + Intergenic
1035366290 7:158350997-158351019 TGTTCTCTGCAGGGATTTCCAGG - Intronic
1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG + Intergenic
1036097845 8:5743452-5743474 TGTTCTCTGTATGGGGTAGGGGG - Intergenic
1037795440 8:21989712-21989734 TTTTCTCAGCAGGGGTTCCAAGG - Intronic
1043103874 8:76083217-76083239 AGTTCTCTACCTGGGCTACAGGG + Intergenic
1048845860 8:138603169-138603191 TGTCCTCTGCATAGGTCTCAGGG - Intronic
1050953609 9:11627714-11627736 TGTGCTCTGCATGTGAGACATGG + Intergenic
1051134940 9:13909592-13909614 TGTTCTTTGCTTGGCTTTCAAGG - Intergenic
1053607436 9:39675121-39675143 TCCTCTCTGCCTGGGGTACAGGG + Intergenic
1053865286 9:42431478-42431500 TCCTCTCTGCCTGGGGTACAGGG + Intergenic
1054246099 9:62667288-62667310 TCCTCTCTGCCTGGGGTACAGGG - Intergenic
1054560221 9:66701821-66701843 TCCTCTCTGCCTGGGGTACAGGG - Intergenic
1057832474 9:98417858-98417880 TCTTCTTTGCCTGGGTAACATGG - Intronic
1059507223 9:114810558-114810580 TCTTCTCTTCATGTGTTAAATGG + Intergenic
1062465997 9:136681881-136681903 TTTTCTCTGCTTGGGTTCCCGGG - Intronic
1189288615 X:39869517-39869539 TTTCCTCTGGATGGGTTTCATGG - Intergenic
1189714020 X:43845971-43845993 TGTGCACTGCATGGGGTTCATGG - Intronic
1192104587 X:68302230-68302252 TCTCCAATGCATGGGTTACATGG + Intronic
1193058776 X:77182306-77182328 TGTGCTCTGGATGTGTGACAAGG + Intergenic
1195246792 X:103002261-103002283 TGTTCTCAGAATTGATTACATGG - Intergenic
1196489035 X:116246514-116246536 TGTTATCAGCGTGGTTTACAAGG + Intergenic
1198763309 X:140056883-140056905 TGTTCTCTGCATTGATTAAGTGG - Intergenic
1201073078 Y:10167839-10167861 AGTCCTTTGCATGGCTTACAAGG - Intergenic