ID: 945440983

View in Genome Browser
Species Human (GRCh38)
Location 2:209879284-209879306
Sequence GGCCCCTGGAAGTTCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945440983_945440988 29 Left 945440983 2:209879284-209879306 CCATCCTGGAACTTCCAGGGGCC 0: 1
1: 1
2: 2
3: 35
4: 291
Right 945440988 2:209879336-209879358 TTAAATGCGTGCATCCTCCTAGG 0: 1
1: 0
2: 1
3: 22
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945440983 Original CRISPR GGCCCCTGGAAGTTCCAGGA TGG (reversed) Intronic
900081814 1:864199-864221 GGCCTCTGGAAGTTACTGCAAGG - Intergenic
900330019 1:2129460-2129482 GGCTCCTGGAAGAGGCAGGATGG + Intronic
901515338 1:9741522-9741544 GGCACCAGGAAGTTCCTGTATGG + Intronic
901742550 1:11351822-11351844 TCCTCCTGGGAGTTCCAGGAAGG - Intergenic
901771668 1:11533636-11533658 AGCCCCAGGCAGTTCCAGGGAGG + Intronic
902408294 1:16198528-16198550 GGCTCCTGGATGGTCCTGGAGGG - Exonic
902552189 1:17225756-17225778 GGACCCAGGAGGCTCCAGGAAGG - Intronic
904348413 1:29889077-29889099 GGCCCCTGGAGGGTCAAGAATGG - Intergenic
904478866 1:30782048-30782070 GGCCCTGGGATGTCCCAGGAAGG + Intergenic
905069021 1:35209036-35209058 TGCCCAAGGAAGTCCCAGGAAGG - Intergenic
905473398 1:38209207-38209229 AGATCCTGGAAGTTCCAGTAGGG - Intergenic
906632279 1:47381746-47381768 GGCTCCAAGAACTTCCAGGAGGG + Intergenic
906654024 1:47534529-47534551 GGCCCAGGGCAGTGCCAGGAGGG - Intergenic
907226537 1:52952479-52952501 GGCCCCTCAAAGTGCTAGGATGG + Intronic
907391035 1:54158365-54158387 AGCCCCTGGAAGTTTGAGGCTGG - Intronic
908689589 1:66763323-66763345 GGGCCCTGGGATTTTCAGGATGG + Intronic
909863345 1:80635543-80635565 GGCCCCTGAAATGTCCAGAAAGG + Intergenic
912523813 1:110266034-110266056 TGCCTCTTGAAGTTCCATGAAGG + Intronic
912879051 1:113390737-113390759 GTCCCCAGGAGGTTCCAGAAGGG - Intronic
914430649 1:147618226-147618248 GCCTCCTGGAAACTCCAGGAGGG + Intronic
914917514 1:151827702-151827724 AGCCCCAGGAAGGCCCAGGAAGG - Intronic
915552448 1:156642974-156642996 GGCCCCTGGCAGTGCTAGGAAGG - Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
916991648 1:170251055-170251077 GGCCAGTGCAAGTTCCAGGTGGG - Intergenic
917961880 1:180152116-180152138 CATCCCAGGAAGTTCCAGGAAGG + Intergenic
919786312 1:201260478-201260500 GGCCCCCGGAGGTGCCCGGATGG - Intergenic
919820354 1:201468505-201468527 GCCCCCTGGAAGATCCCGGCTGG - Exonic
920173734 1:204087407-204087429 GGCCCTGGGAAGCTACAGGAAGG - Intronic
921408303 1:214806477-214806499 GGGCCCTGGAATTTTCAGAATGG - Intergenic
922322978 1:224503881-224503903 GGCCTCTGGCCGCTCCAGGAGGG + Intronic
922417050 1:225431408-225431430 GGCCAGTGCAAGTTCCAGGTGGG + Intergenic
922658998 1:227412711-227412733 GGGCCCTGGAACTTGCAGAATGG + Intergenic
923022845 1:230178304-230178326 GGCCCCTGGCAGTACCTGGAGGG - Exonic
923146713 1:231203618-231203640 GGCCCCCTGAGATTCCAGGAAGG + Intronic
923797373 1:237170925-237170947 AGTTCCTGGAGGTTCCAGGAGGG + Intronic
924644751 1:245867252-245867274 GTCCCCTGGAGTTTCCAGAAAGG + Intronic
1063099166 10:2934764-2934786 GGCCCCGGGAACTTCCCGGTTGG + Intergenic
1065302512 10:24335856-24335878 GTACCTTGGAAGTTCCAGGTGGG - Intronic
1066293598 10:34035437-34035459 GGCCACTGTGAGTTCCAGGTGGG + Intergenic
1066425018 10:35300226-35300248 GGCAGCTGGAATTTCCAGGGCGG - Intronic
1066590588 10:36989607-36989629 GGCCAGTGCAAGTTCCAGGTGGG - Intergenic
1067023016 10:42818570-42818592 GTCGACTGGAAGTTCCTGGAAGG + Intronic
1067726552 10:48775085-48775107 GCCCCCTGGAGGATCCAGGTGGG - Intronic
1069067210 10:63955029-63955051 GGACCCTGGAAATTTCAGAATGG + Intergenic
1070743888 10:78920857-78920879 GGGGCCTGGAAGACCCAGGAAGG + Intergenic
1072741233 10:97911162-97911184 GGCCCCTGGAAATTCCAGGTGGG + Intronic
1072970783 10:100015610-100015632 GTCCCCTGGCTATTCCAGGATGG - Intergenic
1073322157 10:102621981-102622003 GGCCCCAGCAAGTTCCAGAAAGG - Intronic
1073572948 10:104596361-104596383 GGCACCTGGAAGATCCCAGAAGG + Intergenic
1075206524 10:120453990-120454012 GGCTCCTGGTAGTTTCAAGATGG - Intergenic
1076003732 10:126931738-126931760 GGTTCCTGGAAGTGACAGGAAGG - Intronic
1076402698 10:130194219-130194241 GGCCCCTGGAGGTCCCAGGCTGG + Intergenic
1076631458 10:131854643-131854665 GGTCCCAGGTAGTTCCTGGAGGG - Intergenic
1077006569 11:360683-360705 GGCCCATGGGAAGTCCAGGAAGG - Intergenic
1078447964 11:11419043-11419065 GGCCACTGGAAGTCACAGTATGG + Intronic
1080883960 11:36348500-36348522 GGTGCCCGGAAGTTCCAGGAAGG - Intronic
1081590827 11:44421954-44421976 TGCCACTGGGAGTCCCAGGAGGG + Intergenic
1081749474 11:45499574-45499596 GAACCCTGGAGGTTCCTGGAGGG + Intergenic
1083491850 11:63019531-63019553 GCCCCATGGAAGTTTCATGATGG - Intergenic
1084433389 11:69123754-69123776 AGCCCCTGCAAGGGCCAGGAGGG - Intergenic
1084837360 11:71812782-71812804 GTTCCCAGGAAGTCCCAGGAAGG + Intergenic
1085052876 11:73388809-73388831 GGCACCTGGCAGTTTAAGGAAGG + Intronic
1085761190 11:79243022-79243044 GCCCCTTGGGAGCTCCAGGAAGG + Intronic
1087152245 11:94869429-94869451 GGCCGCTGGGTGTTTCAGGACGG - Exonic
1087377731 11:97366061-97366083 GGCCCGGGGAAGATCCAGAAAGG - Intergenic
1087682367 11:101231653-101231675 GGCCAGTGCAAGTTCCAGGTGGG - Intergenic
1089295140 11:117462934-117462956 GGCCCCTGGAATTTCCAACAGGG - Intronic
1089992470 11:122874396-122874418 GGCCACTGAAAGTCCCTGGAGGG - Intergenic
1090036311 11:123252652-123252674 GGGTCCTGGAAGCTCCTGGAGGG + Intergenic
1090183706 11:124722294-124722316 GGCCCCTCCAACTTCCAAGAGGG - Intergenic
1091069998 11:132554054-132554076 GGCCCCAGGAATTTCCAGGCAGG - Intronic
1092401337 12:8181297-8181319 GTTCCCAGGAAGTCCCAGGAAGG - Intronic
1094775677 12:33724437-33724459 GACCCCTGGAAGGTCCATGGAGG - Intergenic
1095092625 12:38121273-38121295 GGGCCCTGGCAGTCCCAGGAGGG - Intergenic
1095294211 12:40509990-40510012 TGCCCCTGGCAGTTCCAACACGG + Intronic
1098282016 12:68871487-68871509 AGCACCTGGTACTTCCAGGAAGG + Intronic
1100981589 12:100166632-100166654 TGCCCCTGGAACTCCCAGCAGGG - Intergenic
1102290129 12:111692617-111692639 GGCCCCTCTGAGCTCCAGGATGG + Intronic
1104823670 12:131693474-131693496 GGCCCCTGGAAGACACATGAGGG - Intergenic
1104843707 12:131836310-131836332 TGCCCCTGGGACTTCCAGGATGG + Intronic
1106854532 13:33835147-33835169 GGCTCCTTGAAGTTCGTGGAAGG + Exonic
1110990517 13:82038103-82038125 GGCCCCTGGAAGTTTCTCCAGGG + Intergenic
1110995762 13:82107180-82107202 GGGCCCTAGAATTTTCAGGATGG + Intergenic
1113974955 13:114220603-114220625 GGCTCCAGGAAGTGCCAGGATGG - Intergenic
1113983541 13:114295910-114295932 GGCCCCAGGCAGCTTCAGGATGG + Intronic
1114591223 14:23866496-23866518 GACCCCAGGAAGCTCCAGCAAGG - Intergenic
1115439275 14:33413336-33413358 GGTCCCTGGAAGCTGCATGAGGG + Intronic
1117088144 14:52222590-52222612 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1117088699 14:52227647-52227669 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1117201402 14:53393626-53393648 GGCCCCTGGAAATCCCAACAAGG - Intergenic
1120948899 14:90022946-90022968 GGCCACTGGAACGTCCAGGTAGG - Intronic
1121650402 14:95553840-95553862 AGCCCCTGGAACTTCTAAGAAGG + Intergenic
1123424167 15:20155742-20155764 GGCGGCTGGAAATTCCTGGAAGG + Intergenic
1123533387 15:21162271-21162293 GGCGGCTGGAAATTCCTGGAAGG + Intergenic
1125099512 15:35894901-35894923 GGCCCCTGGGATTTTCAGAATGG + Intergenic
1125335465 15:38622244-38622266 GGACCCTGGAAGATTAAGGAAGG + Intergenic
1127949700 15:63793114-63793136 CGCCTCTGGCAGTTCCTGGAGGG - Intronic
1128531284 15:68449880-68449902 GACCCTTGGAAGTTACAGGGAGG + Intergenic
1129182809 15:73887638-73887660 AGCACCTGGAAGTTCCTGCAGGG - Exonic
1129231107 15:74197641-74197663 GGGCCCTGGAAGATCCTGGGTGG - Intronic
1129948883 15:79568196-79568218 GGGCCCTGGGATTTTCAGGATGG - Intergenic
1130224639 15:82047281-82047303 GGTCCCTGGGAGATCCGGGAGGG - Intergenic
1130460670 15:84156669-84156691 GCATCCTGGGAGTTCCAGGACGG - Intergenic
1131248273 15:90814559-90814581 AGCCCCAGGAAGCCCCAGGAAGG - Intronic
1131872397 15:96776042-96776064 GGCCTATGGACGTTCCAGGGAGG + Intergenic
1132014978 15:98307549-98307571 GGCCCCTGAGGGTTCCAGTAAGG - Intergenic
1132350084 15:101133979-101134001 GGCCCCAGGAAGTTCCTGCCAGG + Intergenic
1132408516 15:101559834-101559856 GGCCAATGGAGGTTCCAGCAGGG - Intergenic
1132975884 16:2711020-2711042 GGCCCCTGCCAGCTCCAGGAGGG - Intergenic
1133707213 16:8366226-8366248 GGCCCGTGGAAGTCAGAGGAGGG + Intergenic
1133976104 16:10600825-10600847 GTCCCCTGGAAGTTCCTGGAGGG + Intergenic
1136283698 16:29229408-29229430 GGCCCCTGGCAACTCCAGGGCGG + Intergenic
1136860704 16:33700144-33700166 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1137248890 16:46728903-46728925 CGACCCTGGACGTGCCAGGAAGG + Intronic
1137556530 16:49473836-49473858 GGCCTCTGCCTGTTCCAGGAGGG - Intergenic
1137977521 16:53043946-53043968 GGCCAAAGGCAGTTCCAGGAAGG + Intergenic
1138216607 16:55210356-55210378 GGTCCCAGGAAGTACCAGCAGGG + Intergenic
1138459760 16:57141223-57141245 GGCCCCAGGAAAGGCCAGGAAGG + Intronic
1139914712 16:70420955-70420977 GGACCCTGGAAGTTCCAGCTAGG + Intronic
1142088733 16:88198919-88198941 GGCCCCTGGCAACTCCAGGGCGG + Intergenic
1142115436 16:88353831-88353853 GGCAGCTGGAAGGACCAGGAAGG + Intergenic
1203122203 16_KI270728v1_random:1548327-1548349 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1145839827 17:27985001-27985023 GGCCACGTGAAATTCCAGGAAGG + Intergenic
1146105935 17:30037024-30037046 TACCCCTGGAAATTCCAGGTAGG + Intronic
1146296056 17:31651343-31651365 GACAGCTGGAAGTTCCAGAATGG - Intergenic
1148132338 17:45269710-45269732 GGCACATGGAGGTTCCTGGAGGG + Intronic
1150622888 17:66821797-66821819 GGGCCCTGGAGGATCCAGGGAGG - Intergenic
1150656287 17:67041921-67041943 GGGGCCTGGAAGGGCCAGGAAGG - Intergenic
1150694100 17:67389402-67389424 GGGCTATGGAAGTTCCAGGCTGG + Intronic
1151186031 17:72364512-72364534 GGCCCCTGGAACAGACAGGAAGG + Intergenic
1151192197 17:72406751-72406773 GGCACATGGAAGTTCCTGGAGGG + Intergenic
1151299293 17:73210852-73210874 GGCCTCTGAAAGTGCCAGGCAGG + Intronic
1151540981 17:74764401-74764423 GGCCCCTGGAAGTCCCTAGCTGG + Intronic
1152599230 17:81253125-81253147 GGCCCGTGGATGTGCCTGGACGG - Exonic
1153868662 18:9296892-9296914 GGCCAGTGCAAGTTCCAGGTGGG + Intergenic
1156473160 18:37390093-37390115 TGCCCCTGCTAGCTCCAGGATGG + Intronic
1157815234 18:50725260-50725282 TGCCCCTGGAAGTTCAACAAAGG - Intronic
1159956639 18:74523031-74523053 TGCTCCTGGAAATTCCACGAGGG - Exonic
1160537502 18:79602964-79602986 GGACTCTGGAGGTTCCTGGAGGG + Intergenic
1161663246 19:5560051-5560073 GGCCCCTGGGTGTGCCTGGAGGG - Intergenic
1163042297 19:14611543-14611565 GGCCCATGGAACTTCTAGAAAGG + Intergenic
1163325078 19:16598364-16598386 GGGCTCTGGAAGCTCCAGGGAGG - Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1164796714 19:31039624-31039646 GTGCACTGGAAGTTCCGGGAGGG + Intergenic
1165992911 19:39826282-39826304 GCCTCCTGGAAGTGCCAGGGAGG + Exonic
1167620358 19:50556872-50556894 GGGCCCCGGAACGTCCAGGAGGG + Intronic
1168214703 19:54917007-54917029 GGTCACTGCATGTTCCAGGAAGG - Intergenic
1168499998 19:56885269-56885291 GGCCCTTGCAAGGGCCAGGAAGG - Intergenic
1168500440 19:56888375-56888397 GGCCCTTGCAAGGGCCAGGAAGG - Intergenic
926164106 2:10507422-10507444 GGCCCCTGGAGGCTCCAGCAGGG - Intergenic
927181829 2:20452240-20452262 GCCCCCTGGCAGTTGCAAGAAGG + Intergenic
927824265 2:26297158-26297180 AGTGCCTGGAAGTTCTAGGAAGG - Intergenic
927861324 2:26562085-26562107 GCTCCATGGGAGTTCCAGGAAGG - Intergenic
928325982 2:30319883-30319905 AGGCCCTGGAAGCTACAGGAAGG - Intronic
929146255 2:38709204-38709226 GGGGCCTGGCAGTCCCAGGAGGG + Intronic
929588787 2:43132241-43132263 GGCTCCTGGCAGAACCAGGACGG - Intergenic
930014419 2:46960523-46960545 GGCCCCTGCAAGCTCCTGGGTGG - Intronic
930191061 2:48460445-48460467 GGCCTCTGATAGTCCCAGGAAGG + Intronic
930559283 2:52940135-52940157 GGGCCCTGGAATTTTCAGAATGG - Intergenic
930715427 2:54589419-54589441 GCCCTCTGGAAGCTGCAGGAGGG + Intronic
932401522 2:71483854-71483876 GGCTCCTGGAAGCCCCAGGATGG + Intronic
934459082 2:94201297-94201319 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
935333358 2:101993875-101993897 GGCGCTGGGAGGTTCCAGGAAGG - Intronic
936170460 2:110167463-110167485 GGTTCCAGGAACTTCCAGGATGG + Intronic
937286938 2:120759816-120759838 GGCCCTAGGTAGTTTCAGGATGG - Intronic
937887079 2:126907299-126907321 GCCCTCTGGAGGTTCTAGGAAGG - Intergenic
938144502 2:128822332-128822354 TGCCCCTGGCAGCACCAGGAGGG - Intergenic
944334830 2:198520264-198520286 GGACCCTGGAAGGGGCAGGAGGG + Intronic
945440983 2:209879284-209879306 GGCCCCTGGAAGTTCCAGGATGG - Intronic
945912048 2:215660742-215660764 AGCCCAGTGAAGTTCCAGGATGG + Intergenic
946740902 2:222800290-222800312 GGCCCCTGGAAGCCCAAGCAGGG + Intergenic
947034641 2:225838236-225838258 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
947494714 2:230626424-230626446 GGCCCCTGGATATTCTTGGAAGG - Intergenic
948571675 2:238921736-238921758 GGCCCCTGGAAGGGACAGGCAGG + Intergenic
1169214224 20:3784335-3784357 GGGCCCTGGAGGTTCCCGGCCGG - Exonic
1170334213 20:15250091-15250113 GCTACCTGGAAGGTCCAGGAAGG + Intronic
1170462450 20:16589891-16589913 GGCCAGTGAAAGTTCCAGAATGG + Intergenic
1171045129 20:21803356-21803378 GGCCAAAGGAAGTTCCATGAGGG - Intergenic
1174046956 20:47740524-47740546 GGCCACTGGGAGCTCCAGGCAGG + Intronic
1174123704 20:48287324-48287346 GGCCCCTGGCTGCTTCAGGAAGG + Intergenic
1174446158 20:50592702-50592724 AGCTCCTGGAATCTCCAGGAAGG + Intronic
1174603657 20:51744759-51744781 GGACCCTGTAACTTCCTGGAAGG - Intronic
1175138890 20:56845002-56845024 GGCCCATGGATGTGACAGGATGG - Intergenic
1175242259 20:57558454-57558476 GGCCCCAGGAAGGTGCAGGGAGG + Intergenic
1175801188 20:61801843-61801865 GGCCCCTGGGAAATCCAGGATGG + Intronic
1175883969 20:62277906-62277928 GGCCCCTGAAATTTCCGAGATGG - Intronic
1176059624 20:63166798-63166820 GGCACCTGGATGCACCAGGAGGG + Intergenic
1176313089 21:5164972-5164994 AGCCCCAGGAAGTCCCAGCATGG - Intergenic
1176872595 21:14095688-14095710 GAGCCCTGGCAGTCCCAGGAGGG + Intergenic
1177567714 21:22845713-22845735 AGCCCCTGGAGGATCCAGAAAGG - Intergenic
1178691801 21:34755932-34755954 GGCCCCCGGATGTCCCAGTAGGG - Intergenic
1179326711 21:40353589-40353611 TGCCCCTGGAACTTTCAGGGAGG - Exonic
1179434429 21:41350513-41350535 GGACCCGGGGAGCTCCAGGAAGG - Intronic
1179816867 21:43911954-43911976 TGCCCCTGGAGCTTCCAGGCTGG + Intronic
1179843959 21:44097058-44097080 AGCCCCAGGAAGTCCCAGCATGG + Intronic
1180840248 22:18955725-18955747 GGCACCGTGATGTTCCAGGATGG + Intergenic
1181065975 22:20306255-20306277 GGGCCCTGGGGGTACCAGGAGGG - Intergenic
1181161611 22:20963185-20963207 GGCCCCAGGAAGACCCAGGAGGG - Intergenic
1181281863 22:21726254-21726276 GGTCCCAGAAGGTTCCAGGAAGG + Intronic
1181306270 22:21919011-21919033 GGCCTCAGGAGGTGCCAGGAGGG + Intergenic
1181357132 22:22305172-22305194 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1182351739 22:29703606-29703628 GGCCCCTGGAAATGCCAAGTTGG + Intergenic
1182759003 22:32706897-32706919 GGCCCCTGGAATTCCCTAGAGGG + Intronic
1183199009 22:36373152-36373174 GGCCCCTGCCTTTTCCAGGATGG - Intronic
1183266609 22:36830381-36830403 GGCGACTGCAAATTCCAGGATGG + Intergenic
1184265642 22:43344293-43344315 GGCCCCTCTCAGTTCCAGGCAGG + Intergenic
1184376547 22:44117195-44117217 CGGCGCTGGAAGTTGCAGGAGGG + Intronic
1185098780 22:48826449-48826471 GGCTCCTGGGACTTCCGGGAAGG - Intronic
1185171928 22:49299288-49299310 GGACCTGGGAAGTTCTAGGATGG - Intergenic
951040777 3:17986905-17986927 GCCCCTTGTAAGTCCCAGGAGGG + Intronic
954452934 3:50581412-50581434 GGCCCTGGGAAGTGCCAGGGTGG - Exonic
955618675 3:60837123-60837145 AGCCCCTGGAACTTCTAAGAAGG + Intronic
956128066 3:66029689-66029711 GCTCCCAGGAAGTTCCAGTAGGG - Intronic
957692529 3:83590603-83590625 AACCACTGGGAGTTCCAGGAGGG - Intergenic
960545451 3:118909050-118909072 TTCCCCTAGAAGTACCAGGAAGG - Intronic
961504074 3:127358683-127358705 GACCCATGCAAGTTCCTGGAGGG - Intergenic
962679470 3:137783713-137783735 GGCCAGTGGAAGTGACAGGAAGG - Intergenic
963793104 3:149604528-149604550 GAGCCCTGGGACTTCCAGGAGGG + Intronic
965531371 3:169773529-169773551 GGCTCCTTGGAGTTCCAGCACGG + Intronic
967829425 3:193906113-193906135 GGGCCCTGGAAGGTTCCGGAAGG + Intergenic
968086687 3:195877050-195877072 GTCCCCTGGAAGTACCTGGCAGG - Intronic
968688421 4:1976903-1976925 AGCCCCTGGAACCTCCAGGAGGG + Intronic
968896943 4:3409830-3409852 GGCCCTGGGAAGAACCAGGACGG - Intronic
969677129 4:8620326-8620348 AGCCCCGGGATCTTCCAGGAAGG + Intergenic
969678082 4:8625965-8625987 AGCCCCGGGATCTTCCAGGAAGG + Intergenic
969679037 4:8631602-8631624 AGCCCCGGGATCTTCCAGGAAGG + Intergenic
969969307 4:11029242-11029264 GGCCCTGGGAATTTCCAGAATGG + Intergenic
971273452 4:25172825-25172847 AGCCCCTGGAACTTCTAAGAAGG + Intronic
975744929 4:77466429-77466451 GGCCAGCGCAAGTTCCAGGAGGG + Intergenic
975761977 4:77629439-77629461 GGGCCCTAGAATTTCCAGAATGG + Intergenic
977235812 4:94506016-94506038 GGCCCCAGGTAGCTTCAGGATGG - Intronic
979013533 4:115401338-115401360 AGCCCCTGGAACTTCTAAGAAGG + Intergenic
983262192 4:165469398-165469420 GGCCCCTGGAAGCTGCCGGCTGG + Intronic
984862459 4:184252983-184253005 GGCCAGTGCAAGTTCCAGGTAGG + Intergenic
984940548 4:184928512-184928534 GGCATCTGGAATTTGCAGGATGG - Intergenic
985430317 4:189873044-189873066 GGGCCCTGGAATTTTCAGAATGG - Intergenic
985629112 5:1005601-1005623 GGCCCCTGGAAGAGGCAGGCAGG + Intergenic
985720449 5:1486050-1486072 GGGCCCAGGACCTTCCAGGAGGG + Intronic
985830091 5:2221719-2221741 CTACCCAGGAAGTTCCAGGAGGG - Intergenic
987554025 5:19422164-19422186 AGCCCCTGGAACTTCTAGGAAGG + Intergenic
987568330 5:19622770-19622792 GGTCCAGGGAAGTTCAAGGATGG - Intronic
988584543 5:32497237-32497259 AGCTCCTGGAGGTTCCTGGAGGG + Intergenic
991510752 5:67374261-67374283 GTACCCAGGAAGTCCCAGGAAGG + Intergenic
994812480 5:104539240-104539262 GGCACTTGGAAGTTGCAGGTTGG - Intergenic
998039625 5:138944148-138944170 GGCCCTGGGAAGATACAGGAAGG - Intergenic
1000085842 5:157886900-157886922 GGCCAGTGAAAGTTCCAGGTGGG + Intergenic
1000279302 5:159768460-159768482 GACTCCTGGAAGATGCAGGACGG + Intergenic
1001204781 5:169752334-169752356 AGCCCCTGGAGTGTCCAGGAGGG + Intronic
1001437859 5:171714584-171714606 GGCCTCTGGGAGTCCAAGGATGG - Intergenic
1001612572 5:173015412-173015434 GCCCCTTGGTAGCTCCAGGATGG + Intronic
1001616206 5:173045463-173045485 GGCACCTGCAAGTCCCAGGGAGG + Intergenic
1001772219 5:174305153-174305175 AGCCCATGAAAGTCCCAGGAGGG + Intergenic
1002562018 5:180088866-180088888 GCCCCCAGGTAGCTCCAGGATGG - Intergenic
1003486803 6:6587134-6587156 AGCCCCTAGAAGGTCCAGGATGG - Intergenic
1004717108 6:18228384-18228406 TGCCCCGGGAGGTTCCAAGATGG + Intronic
1005699361 6:28384374-28384396 TGCTCCTGGAAGTCCCAAGAAGG - Intronic
1007211688 6:40197551-40197573 GATCCCAGGAAGCTCCAGGAGGG + Intergenic
1012444915 6:99297528-99297550 TGCCCCTGAAAGTTCCAGTGGGG + Intronic
1012499744 6:99875419-99875441 GGCCCTTGCAGGTTCCAGGCTGG - Intergenic
1013901309 6:115160148-115160170 GGCCTCTGGAAGCTTCAAGAAGG + Intergenic
1014179732 6:118371737-118371759 GAGCCCTGGAAGGGCCAGGATGG - Intergenic
1015221828 6:130813049-130813071 GGCCCCTCTAATTCCCAGGAGGG - Intergenic
1017290518 6:152730242-152730264 GGCCCTTGGAACTTCTAAGATGG - Intergenic
1018756324 6:166852742-166852764 GGCCCCTGGATGTCCCTGTAAGG + Intronic
1019154548 6:170030269-170030291 GGCTCTGGGAAGCTCCAGGAAGG - Intergenic
1019299011 7:294172-294194 GGCCCCCGGTTGTTCCTGGAGGG + Intergenic
1019484927 7:1285026-1285048 GGGCCCAGGGCGTTCCAGGACGG + Intergenic
1019698318 7:2460243-2460265 GGCTCCTGGCAGCCCCAGGAAGG - Intergenic
1020142447 7:5619999-5620021 GGCCCCTGTAACTTGCCGGATGG + Intergenic
1021842025 7:24728559-24728581 GGGCCCAGGAAGGTTCAGGAGGG - Intronic
1023073350 7:36459337-36459359 AGCCCCTGGAACTTCTAAGAAGG - Intergenic
1024295068 7:47835166-47835188 GGCCCCTGGAGAAGCCAGGAGGG + Exonic
1024563290 7:50662171-50662193 AGCCCCTGGCAGTCCCAGGCTGG + Intronic
1026521378 7:71121115-71121137 GTTCCCTGGAACTTCCAGAAAGG + Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029345568 7:99976104-99976126 GGCCAATGGGAGTGCCAGGACGG + Exonic
1029458435 7:100682559-100682581 GGCACCTGGAGGCTCCGGGATGG - Intronic
1029585661 7:101469191-101469213 GACCCCCAGAATTTCCAGGAGGG - Intronic
1031187627 7:118502682-118502704 AGCCCCTGGAATTTCTAAGAAGG + Intergenic
1033045577 7:137959290-137959312 GGCAGCTGAAGGTTCCAGGAGGG - Intronic
1033285528 7:140037744-140037766 GCCACCTTGAAGTTCCAGGCCGG - Exonic
1034429690 7:151034978-151035000 GGACCATGGAAGTTCATGGAAGG + Intronic
1035329386 7:158086148-158086170 GGCCCCTGGAATTTCTAAGCAGG - Intronic
1035395271 7:158530845-158530867 GTCCCATGCAGGTTCCAGGAAGG + Intronic
1035523456 8:293354-293376 GGCCTCTGGAAGTTACTGCAAGG + Intergenic
1036276222 8:7354246-7354268 GTTCCCAGGAAGTCCCAGGAAGG + Intergenic
1036345125 8:7956101-7956123 GTTCCCAGGAAGTCCCAGGAAGG - Intergenic
1036840458 8:12116868-12116890 GTTCCCAGGAAGTCCCAGGAAGG - Intergenic
1036862256 8:12363113-12363135 GTTCCCAGGAAGTCCCAGGAAGG - Intergenic
1042537587 8:69874111-69874133 GGTCACTGGAAATTGCAGGAGGG - Intergenic
1042786082 8:72548569-72548591 AGGCCCTATAAGTTCCAGGAAGG - Intronic
1044192131 8:89331582-89331604 GGCATCTGAAAGTTCAAGGATGG + Intergenic
1047641994 8:126830548-126830570 GGCCCCTGTAATTTTCAGAAGGG + Intergenic
1047969444 8:130072188-130072210 GGCTCCTGGAGTTTCCAGAAAGG + Intronic
1049179769 8:141216228-141216250 GGCCCCTGGGAGCTGCAGGAAGG - Intronic
1049221889 8:141432197-141432219 GGCCCCAGGAGGTTCCCGCAAGG + Exonic
1049608190 8:143539432-143539454 AGCCCCTGCCAGTTTCAGGAGGG + Intronic
1051073504 9:13202597-13202619 AACCACTGGGAGTTCCAGGAGGG - Intronic
1051542914 9:18240484-18240506 GGGCCCTAGAATTTTCAGGATGG + Intergenic
1053689574 9:40577086-40577108 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054274456 9:63053971-63053993 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1054300820 9:63378025-63378047 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054400368 9:64710958-64710980 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054433959 9:65195216-65195238 GGCGACTGGAAGTTCCTGGAAGG - Intergenic
1054496428 9:65826454-65826476 GGCGACTGGAAGTTCCTGGAAGG + Intergenic
1056604686 9:88076791-88076813 GGGCCCTGGAAGCTCCAGGCGGG - Intergenic
1056773819 9:89497719-89497741 GGCCCCGGGGGGATCCAGGAAGG + Intronic
1056823450 9:89860521-89860543 GACCCCTGGAAGCTCCAGGCTGG - Intergenic
1057072811 9:92115056-92115078 GTCCCCTGGAAGCTCCGGAAAGG - Intronic
1057214204 9:93219099-93219121 GGCACCTGGATGTCCCTGGAGGG + Intronic
1058241554 9:102568773-102568795 ATCCCGTGGAAGTACCAGGAGGG + Intergenic
1060528135 9:124332026-124332048 TGCCCCTGAAAATGCCAGGAAGG - Intronic
1061039506 9:128131762-128131784 GGTCCCTGGAAGCTCCAGGCTGG + Intergenic
1061147651 9:128809134-128809156 GGGTCCTGCCAGTTCCAGGAGGG + Exonic
1061425763 9:130497589-130497611 GGCTGCTGGGAGTTCCAAGAGGG - Intronic
1061809613 9:133154780-133154802 GGCCCCAGGAAGTTCCAGGAAGG + Intronic
1062104033 9:134742945-134742967 GGGCCCTGGAAGTCCATGGAAGG - Intronic
1186529418 X:10280151-10280173 ACCCCCTGGAAGTACCAAGATGG + Intergenic
1187470286 X:19563451-19563473 CGCCTCTGTAAGTTCGAGGAAGG + Intronic
1189209810 X:39275660-39275682 GGCCAGTGCAAGTTCCAGGTGGG + Intergenic
1189563968 X:42220218-42220240 GGCCCGGGCAACTTCCAGGAAGG - Intergenic
1192570805 X:72202966-72202988 GGCCCCTAGTAGCTTCAGGATGG + Intronic
1193485652 X:82082991-82083013 GGCCCCTGGAACATCCAAAATGG - Intergenic
1193860106 X:86654323-86654345 GGCTCCTGGAAATTCAAGCATGG + Intronic
1196713202 X:118785339-118785361 GAACTCTGGAAGTTCCAGGTGGG - Intronic
1196800375 X:119537889-119537911 GGTCCCAGGAAGGCCCAGGATGG - Intergenic
1198610528 X:138394972-138394994 GACACCTGGATGTTCTAGGATGG + Intergenic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic
1202378578 Y:24258511-24258533 GCATCCTGGGAGTTCCAGGACGG + Intergenic
1202492204 Y:25411610-25411632 GCATCCTGGGAGTTCCAGGACGG - Intergenic