ID: 945447842

View in Genome Browser
Species Human (GRCh38)
Location 2:209959422-209959444
Sequence ATGTAGCAGCTGTGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945447842_945447847 22 Left 945447842 2:209959422-209959444 CCCTCTTCTCACAGCTGCTACAT 0: 1
1: 0
2: 3
3: 43
4: 531
Right 945447847 2:209959467-209959489 TTAATCTTTCACAATTTCCCAGG 0: 1
1: 0
2: 1
3: 29
4: 385
945447842_945447848 23 Left 945447842 2:209959422-209959444 CCCTCTTCTCACAGCTGCTACAT 0: 1
1: 0
2: 3
3: 43
4: 531
Right 945447848 2:209959468-209959490 TAATCTTTCACAATTTCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945447842 Original CRISPR ATGTAGCAGCTGTGAGAAGA GGG (reversed) Intronic
900999991 1:6144142-6144164 GTGTTGCAGCTTTGACAAGAAGG - Exonic
901919824 1:12528085-12528107 AGCCAGGAGCTGTGAGAAGACGG + Intergenic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903850014 1:26300452-26300474 ATTTAGCAGGTCTGAGAAAAGGG - Intronic
904083981 1:27890669-27890691 ATCTAGCAGCTGTGTAGAGAAGG - Intergenic
904313150 1:29642231-29642253 ATGAAGGAACTGTGAGCAGATGG + Intergenic
905264716 1:36743726-36743748 ATGAAGCAGCTCCCAGAAGAAGG - Intergenic
906102724 1:43273398-43273420 CTGAGGCCGCTGTGAGAAGAAGG - Exonic
906937342 1:50225831-50225853 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
906975789 1:50571377-50571399 ATTTAGCAGCTGTGTGACCATGG + Intronic
906991805 1:50747152-50747174 CTGGTGGAGCTGTGAGAAGAAGG + Intronic
907616730 1:55933943-55933965 CTGGTGGAGCTGTGAGAAGACGG - Intergenic
907835930 1:58108255-58108277 ATGTCACAGGTGTGAGATGAGGG + Intronic
908091057 1:60686013-60686035 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
908627204 1:66058392-66058414 CTATTGGAGCTGTGAGAAGAGGG - Intronic
909023716 1:70460401-70460423 CTCTTGGAGCTGTGAGAAGAGGG + Intergenic
909024092 1:70463207-70463229 CTGCTGGAGCTGTGAGAAGAGGG + Intergenic
909229059 1:73062195-73062217 CTACTGCAGCTGTGAGAAGAGGG + Intergenic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
909357461 1:74726137-74726159 CTGGTGGAGCTGTGAGAAGAAGG - Intronic
909439795 1:75684838-75684860 ATGATGGAGCTATGAGAAGAGGG - Intergenic
909632899 1:77785883-77785905 CTAGTGCAGCTGTGAGAAGAGGG - Intronic
909792393 1:79695424-79695446 ATGTGGCAGTAGTGAGAAGTGGG - Intergenic
910001726 1:82350085-82350107 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
911213268 1:95164994-95165016 ATGTGGGAGCTGGGAAAAGACGG - Intronic
911775417 1:101804905-101804927 ATGTACCAGACCTGAGAAGAAGG + Exonic
912084058 1:105977102-105977124 TTGGTGGAGCTGTGAGAAGAGGG + Intergenic
912084535 1:105982273-105982295 CTGGGGGAGCTGTGAGAAGAGGG + Intergenic
913152895 1:116063237-116063259 ATGTAGGCTCTGTGAGAATAGGG - Intronic
916205136 1:162308933-162308955 ATGCAGCAGCTGTGTGACCATGG - Intronic
916551924 1:165858093-165858115 ATGTATCAGTTGTGTGAATAAGG + Intronic
917228855 1:172814253-172814275 CTGATGGAGCTGTGAGAAGAAGG - Intergenic
917661160 1:177178399-177178421 AAGTGGCTGCTGTGAGAAGCGGG - Intronic
917686393 1:177420689-177420711 TTGTGGTAGCTGTGAGAGGAAGG - Intergenic
917738785 1:177944013-177944035 ATGTAGAAACGTTGAGAAGAGGG + Intronic
918138745 1:181702148-181702170 ATGGAGCAGGTTTGGGAAGAGGG - Intronic
918614055 1:186524002-186524024 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
918728782 1:187962184-187962206 AGTAAGCAGCTGTGAGAATATGG + Intergenic
919706643 1:200682511-200682533 ATTTAGAAGCTTTGAAAAGACGG + Intergenic
919972743 1:202591458-202591480 AAGTAGCAGAGGTGAGTAGAGGG - Exonic
920331294 1:205210745-205210767 ATGAGGCAGCTCTGTGAAGAGGG - Intronic
921979043 1:221235004-221235026 CTGTAGCAGCTGTGAAATGTAGG - Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923428060 1:233891697-233891719 CTGGTGGAGCTGTGAGAAGATGG + Intergenic
924083130 1:240420277-240420299 ATGTGGAAGCTGAGAGAAGTAGG - Intronic
924147400 1:241090284-241090306 ATGCAACAGATATGAGAAGAGGG + Intronic
924192919 1:241574019-241574041 ATTTTGCAGCTGTGATAAAAGGG + Intronic
1063434176 10:6017409-6017431 ATGCAACAGCTTGGAGAAGATGG - Intronic
1066041019 10:31548132-31548154 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1067454724 10:46411107-46411129 TTGTGGCTGCTGTGAGAATAAGG + Intergenic
1067458001 10:46437223-46437245 ATGCAGCAGTTTTGAGAGGAGGG - Intergenic
1067491162 10:46704711-46704733 ATGTAGCATCTGTTATAACAGGG + Intergenic
1067603504 10:47635669-47635691 ATGTAGCATCTGTTATAACAGGG - Intergenic
1067629196 10:47947411-47947433 ATGCAGCAGTTTTGAGAGGAGGG + Intergenic
1067632480 10:47973532-47973554 TTGTGGCTGCTGTGAGAATAAGG - Intergenic
1068138832 10:52978361-52978383 AGGTAGAAGTTGTGGGAAGAGGG - Intergenic
1068235831 10:54231531-54231553 CTATTGGAGCTGTGAGAAGAAGG + Intronic
1068284224 10:54913576-54913598 TTGGTGAAGCTGTGAGAAGAGGG + Intronic
1068389656 10:56378306-56378328 TTGTTGTAGCTGTGAGCAGATGG + Intergenic
1068393644 10:56432140-56432162 ATGTAGCATCTGTTATAACAAGG - Intergenic
1068434541 10:56973618-56973640 ATACTGGAGCTGTGAGAAGAGGG - Intergenic
1068449309 10:57165457-57165479 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
1069577532 10:69541508-69541530 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1070858757 10:79630926-79630948 ATGTAGCATCTGTTATAACAAGG + Intergenic
1071502045 10:86211100-86211122 ATGGAGCAGCCCTGTGAAGAGGG - Intronic
1072136815 10:92554909-92554931 ATGCAGGAGCTGTGAAAAAAGGG + Intronic
1072866465 10:99067305-99067327 ATAGGGCAGCTGTGAGAAGAGGG - Intronic
1073846954 10:107567822-107567844 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1074153882 10:110781848-110781870 CTGTAGCATCTGTGACAAGAAGG + Exonic
1074684327 10:115945691-115945713 ATCTAGCAGCTAGGAGAGGAAGG - Exonic
1074818969 10:117165266-117165288 ATGCAGAAGCAGTGAGCAGACGG - Intergenic
1075590555 10:123688190-123688212 ATGAGGCAGCGGTGAGAAGAAGG + Exonic
1075756955 10:124820406-124820428 AGGTAGCATCTGAGAGATGAGGG - Intronic
1076438546 10:130463205-130463227 CTGGAGCAGCTGACAGAAGAGGG + Intergenic
1076926779 10:133494706-133494728 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1078771455 11:14356575-14356597 ATTTATCGGCTGTGAGAACATGG - Intronic
1079104670 11:17562962-17562984 CTACAGCAGCTGTGAGAACATGG + Intronic
1079442651 11:20530877-20530899 ATGTATCAGCTGAGAGCTGAAGG + Intergenic
1079521194 11:21328553-21328575 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
1079759462 11:24310560-24310582 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1080237432 11:30088020-30088042 ATGTAGTTGCTTTGAGAAAAAGG + Intergenic
1080359300 11:31494065-31494087 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1080653649 11:34242011-34242033 ATGCAGAAGCTGCGAGGAGATGG + Intronic
1081054140 11:38386982-38387004 ATGTAGAAGCTGAGACAAAAGGG - Intergenic
1081160621 11:39743732-39743754 CTATTGGAGCTGTGAGAAGATGG + Intergenic
1083121836 11:60520782-60520804 CTGGTGGAGCTGTGAGAAGAAGG - Intronic
1083736708 11:64685625-64685647 AGGTAGGAGGAGTGAGAAGAAGG - Exonic
1083869855 11:65480026-65480048 ATACACCAGCTTTGAGAAGAGGG - Intergenic
1084880766 11:72169913-72169935 CTAGGGCAGCTGTGAGAAGAGGG + Intergenic
1085987151 11:81801099-81801121 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1087393598 11:97569637-97569659 CTATTGGAGCTGTGAGAAGATGG - Intergenic
1087438340 11:98151308-98151330 CTAATGCAGCTGTGAGAAGAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087725186 11:101708066-101708088 TTATTGGAGCTGTGAGAAGAGGG + Intronic
1087897821 11:103606717-103606739 ATGTACCACCTTTGGGAAGATGG + Intergenic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088355720 11:108941990-108942012 AGGCAGCAGCTGTGAGAATAGGG - Intergenic
1088440796 11:109867826-109867848 ATGTAGCAGCTGTGACCAAGGGG - Intergenic
1090180883 11:124698491-124698513 AGGTGGAAGCTGGGAGAAGAAGG - Intergenic
1090842809 11:130507526-130507548 ATGGTGGAGCTGTGAGAAGAGGG + Intergenic
1091590760 12:1841793-1841815 ACGTGGCAGATGTGAGAAGCTGG - Intronic
1093420142 12:18965414-18965436 ATGTGGCTGCTGTCAGGAGATGG + Intergenic
1093624276 12:21327375-21327397 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
1094431923 12:30379518-30379540 ATGTATAAACTGTCAGAAGAAGG - Intergenic
1094762604 12:33551577-33551599 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1095176889 12:39102980-39103002 CTGTAGGAGCTGTGAGATGAAGG - Intergenic
1095235048 12:39785572-39785594 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
1096050839 12:48606166-48606188 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1097136903 12:56864617-56864639 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1097521951 12:60680801-60680823 CTAGTGCAGCTGTGAGAAGAAGG - Intergenic
1097735453 12:63176756-63176778 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
1098314625 12:69180455-69180477 ATTTGACAGCAGTGAGAAGACGG - Intergenic
1098521110 12:71436358-71436380 TTGGTGGAGCTGTGAGAAGACGG - Intronic
1099044788 12:77703866-77703888 ATGCTGCAGAAGTGAGAAGATGG + Intergenic
1099655042 12:85479070-85479092 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1099668481 12:85660296-85660318 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1099700371 12:86075504-86075526 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1100147721 12:91698286-91698308 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1100596748 12:96078473-96078495 AAGCTGAAGCTGTGAGAAGAAGG - Intergenic
1101736365 12:107466273-107466295 ATGGAGCAGAGGTTAGAAGAGGG + Intronic
1102528706 12:113530526-113530548 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1102664901 12:114563512-114563534 ATGAAGAGACTGTGAGAAGATGG - Intergenic
1103328037 12:120134565-120134587 ATTGAGCAGCTCTGTGAAGAGGG + Exonic
1103752512 12:123175052-123175074 ATGTACCTGCCATGAGAAGATGG - Intronic
1104543117 12:129685638-129685660 CTAAAGGAGCTGTGAGAAGAGGG + Intronic
1104829965 12:131743688-131743710 CTAGTGCAGCTGTGAGAAGAGGG - Intronic
1105235975 13:18554004-18554026 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1107161419 13:37233168-37233190 ATGTAGCAACTGTTATAAAATGG - Intergenic
1107803265 13:44130707-44130729 ATGGAGCAGCCATGAGCAGATGG - Intergenic
1108155858 13:47584135-47584157 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
1109091550 13:58052428-58052450 CTAATGCAGCTGTGAGAAGAGGG + Intergenic
1109221751 13:59647101-59647123 ATAATGGAGCTGTGAGAAGAGGG + Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1109576326 13:64263817-64263839 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1109730450 13:66406245-66406267 AAGTAGCAGCTGTGAGACTTGGG + Intronic
1110232735 13:73183520-73183542 ATGGAGCAACTGTGAGAACTTGG + Intergenic
1111029347 13:82575193-82575215 ATATTGGAGCTGTGAGAAGAGGG - Intergenic
1111325792 13:86694738-86694760 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1111679641 13:91427184-91427206 CTAGTGCAGCTGTGAGAAGAGGG + Intronic
1111823463 13:93241986-93242008 ATGTAGCGGGTGTGTGAATAGGG + Intronic
1111918189 13:94383407-94383429 ATGAAGCAGCTGTGATCAAAAGG + Intronic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112468482 13:99666728-99666750 ATGTAGCAGGTGTCAAAATATGG + Intronic
1113272309 13:108686808-108686830 ATGCCGCAGCAGTGGGAAGAGGG + Intronic
1115112335 14:29839539-29839561 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1115121429 14:29942002-29942024 CTAGAGGAGCTGTGAGAAGAGGG + Intronic
1115130340 14:30046660-30046682 CTAGAGGAGCTGTGAGAAGAGGG - Intronic
1115628549 14:35219961-35219983 AGAAAGCAGTTGTGAGAAGATGG - Intronic
1115914391 14:38295047-38295069 ATGTTGAAGCTTTGTGAAGACGG - Intergenic
1116356408 14:43936813-43936835 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1116393637 14:44422610-44422632 CTGGTGCAGCTGTGAGGAGAGGG - Intergenic
1116694102 14:48150226-48150248 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
1116714129 14:48406862-48406884 CTGCTGAAGCTGTGAGAAGAGGG - Intergenic
1116784154 14:49269040-49269062 CTATTGGAGCTGTGAGAAGACGG + Intergenic
1117045216 14:51806670-51806692 ATATACCAGCTGTGAGAATCTGG - Intergenic
1117085521 14:52196574-52196596 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1117186321 14:53244078-53244100 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1117334007 14:54741346-54741368 ATGTACCATCTTTGAGAACATGG - Intronic
1117440179 14:55752382-55752404 ATTTAGGAGCACTGAGAAGAGGG - Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1117841001 14:59860533-59860555 ATAGTGGAGCTGTGAGAAGAGGG + Intronic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1118039929 14:61905601-61905623 AGCTAGCAGGTGTAAGAAGAGGG - Intergenic
1118668975 14:68101780-68101802 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1119848135 14:77846253-77846275 GAGAGGCAGCTGTGAGAAGACGG - Intronic
1120492797 14:85197933-85197955 CTCCAGCAGCTGTGAGAAGTTGG + Intergenic
1120860527 14:89251206-89251228 ATGTAGGATATGTGGGAAGAAGG - Intronic
1120926796 14:89805222-89805244 ATGTAGCAGCTGTGTGATTGTGG + Intronic
1121357795 14:93230403-93230425 ATGTTGGAGCTGTTAGAAGATGG + Intergenic
1122379919 14:101295509-101295531 CTATTGTAGCTGTGAGAAGAGGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123138277 14:106050650-106050672 ATAGTGCAGCTGTGAGAAGAGGG + Intergenic
1125027319 15:35043937-35043959 AAGTAACAGCACTGAGAAGAAGG - Intergenic
1125233406 15:37483875-37483897 GCCTAGGAGCTGTGAGAAGAGGG - Intergenic
1126193249 15:45901236-45901258 ATATAGCAGCTGGGGTAAGAGGG - Intergenic
1128016331 15:64350926-64350948 ATATAGAAGCTCTGAGAAGCTGG - Intronic
1128979996 15:72179163-72179185 CTGTAGCAGCTTTGAGATGAAGG + Intronic
1131723862 15:95201674-95201696 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
1132561509 16:596708-596730 GAGGAGCAGCTGTGGGAAGAAGG + Intronic
1133427880 16:5708788-5708810 AAGAAGTAGCTGTGAGATGAGGG + Intergenic
1134384574 16:13759733-13759755 AGGTATCAGGTGTGAGAAGATGG + Intergenic
1136080978 16:27852505-27852527 ATATAGCAGCTGAGAGTGGAAGG + Intronic
1136626933 16:31466989-31467011 ATGGAGGAGCGGTGAGAACATGG + Exonic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1138177906 16:54918506-54918528 TTGTAGCAGCTATAGGAAGATGG - Intergenic
1139209765 16:65065756-65065778 CTGTAGCAGCTGTGTGAAAGAGG - Intronic
1139528755 16:67531328-67531350 CTGTAGCACCTGGGAGATGAAGG - Intronic
1140737695 16:77912867-77912889 ATGAGGAAGCAGTGAGAAGACGG - Intronic
1140857347 16:78989720-78989742 ATGGAGCAGGTGTGCAAAGAGGG + Intronic
1141318533 16:82984618-82984640 TTGTAGCAACTGTCTGAAGAAGG + Intronic
1142281202 16:89148631-89148653 CTACTGCAGCTGTGAGAAGAGGG - Intronic
1142840191 17:2622706-2622728 GAGTCCCAGCTGTGAGAAGAGGG - Intronic
1143364106 17:6394494-6394516 GCCTGGCAGCTGTGAGAAGAGGG - Intronic
1143435456 17:6921266-6921288 ATGTGGCAGCTGTAAGGAGATGG + Intronic
1143707644 17:8710156-8710178 ATGTAACAGCTGGAAGAAGTAGG - Intergenic
1143721165 17:8810927-8810949 GGCTAGGAGCTGTGAGAAGAGGG - Intronic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1146744293 17:35314160-35314182 ATGTCTCAGCTGAGATAAGAAGG - Intergenic
1147733696 17:42620321-42620343 ATGTACCAGCTGTGTGATGTTGG - Intergenic
1149145769 17:53490931-53490953 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1150437224 17:65163607-65163629 ATGGTGCTGCTGTGAGATGAGGG + Intronic
1150751615 17:67868775-67868797 ATGTAGAATATGTGAGAACAAGG - Intronic
1153549711 18:6249071-6249093 ACATAGTAGATGTGAGAAGAAGG - Intronic
1153807426 18:8721504-8721526 CCGAGGCAGCTGTGAGAAGAGGG - Intronic
1155544725 18:26903504-26903526 CTGGCGGAGCTGTGAGAAGATGG - Intergenic
1155566306 18:27138407-27138429 ATGTAGAAGCTGGCAGGAGAAGG - Intronic
1155764108 18:29605840-29605862 TTAGTGCAGCTGTGAGAAGAGGG + Intergenic
1156319628 18:36006865-36006887 ATGTATCATCTGTGGGAAGGAGG - Intronic
1156717828 18:40032936-40032958 TTGTAGCAGATATTAGAAGAAGG - Intergenic
1156854321 18:41764682-41764704 ATGGAGCAGATGTGATAACAAGG - Intergenic
1158222097 18:55160498-55160520 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
1158486251 18:57868631-57868653 ATGTAACAGTTGTTAGATGAAGG + Intergenic
1159029522 18:63216901-63216923 ATGTGCCAACTGTTAGAAGAAGG - Intronic
1159357800 18:67359034-67359056 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1159741067 18:72171369-72171391 ATGTAGTATCAGTGAGAAAAGGG + Intergenic
1159761266 18:72429870-72429892 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1163879482 19:19904834-19904856 TGGTGGCAGCTGTGAGAAAAGGG - Intronic
1163901097 19:20100886-20100908 ATGTATCACCTGAGAGCAGAGGG + Intronic
1163914838 19:20231979-20232001 TGGTAGCAGCTGTGTGAAAAGGG + Intergenic
1164422433 19:28106547-28106569 ATGAAGGAGCTTGGAGAAGAAGG + Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1165766198 19:38352657-38352679 TGTGAGCAGCTGTGAGAAGAGGG + Intronic
1166250925 19:41570372-41570394 AGGTGGCAGCAGTGAGAGGATGG - Intronic
1166629170 19:44390134-44390156 CTATTGGAGCTGTGAGAAGAGGG + Intronic
1167810269 19:51823730-51823752 ATGTTTCAGGTGTGGGAAGATGG + Exonic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925783997 2:7410628-7410650 ATGTAGCAGTTGGGCAAAGAAGG + Intergenic
926415858 2:12649366-12649388 ATCCAGCACCTGTGAAAAGAAGG + Intergenic
926467956 2:13214922-13214944 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
926597733 2:14809694-14809716 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
926886338 2:17602174-17602196 ATGGAGCACCTGCGGGAAGAAGG + Intronic
927490790 2:23519521-23519543 ATTTAGGAGCTGTCAGCAGAGGG + Intronic
928226535 2:29453750-29453772 ATGGAGCAAGTGTGAGGAGAAGG + Intronic
928388937 2:30894195-30894217 CTGTAACTGCTGTGAGAGGAAGG - Intergenic
929121840 2:38489957-38489979 GTCCAGCAGCTGTGGGAAGATGG - Intergenic
929578997 2:43070044-43070066 CTGGAGAAGCTGGGAGAAGAGGG - Intergenic
930406767 2:50968330-50968352 GTGTAGGAGATCTGAGAAGATGG - Intronic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
930599981 2:53431938-53431960 ATGCACCAGCTTTGTGAAGATGG - Intergenic
931734704 2:65183024-65183046 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
931948997 2:67340394-67340416 ATTTAGCACTTGTGACAAGATGG - Intergenic
931949801 2:67349948-67349970 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
932575018 2:72958048-72958070 CTGCAGCAGCTGTGAGACCAGGG + Intronic
932595240 2:73089307-73089329 TTGTACCACCTGTGAGAAGAGGG + Exonic
932915734 2:75856035-75856057 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
933480560 2:82851775-82851797 ATGCAGCAGCTGAGAGAAAAAGG + Intergenic
933508086 2:83204112-83204134 CTGGAGGAGCTGTGAGAAGAGGG - Intergenic
935239774 2:101168398-101168420 ATAGAGAAGCTGTGAAAAGAAGG + Intronic
935755090 2:106270574-106270596 GAGTAGCAACAGTGAGAAGAGGG + Intergenic
935959831 2:108413953-108413975 AGTCAGCAGATGTGAGAAGAGGG - Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936523435 2:113226920-113226942 ATGTAGCAGGCCTGGGAAGAAGG + Intronic
937427685 2:121813649-121813671 CTGGTGGAGCTGTGAGAAGACGG + Intergenic
937461941 2:122096871-122096893 AAGCTGCAGCTGTGAGAACAAGG + Intergenic
937762951 2:125627737-125627759 ATATTGGAGCTGTGAGAAGAGGG + Intergenic
938114957 2:128596556-128596578 ATCATGCAGCTGTGACAAGAGGG + Intergenic
938310001 2:130283686-130283708 AGAGAGCAGCTGTGAGAAGCTGG - Intergenic
938444918 2:131368684-131368706 AGAGAGCAGCTGTGAGAAGCTGG + Intergenic
938513811 2:131980605-131980627 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
939403365 2:141724349-141724371 ATGTAGCTGCTGGTAAAAGAGGG + Intronic
939545652 2:143549575-143549597 ATCTAACAGCTGTGAGAACTGGG + Intronic
939667135 2:144965713-144965735 TTAGAGAAGCTGTGAGAAGAGGG + Intergenic
939898094 2:147817083-147817105 CTGCAGCAGCTGCGAGAAGAGGG - Intergenic
940143797 2:150523925-150523947 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
941014135 2:160335305-160335327 ATGGAGTAGCTGGGAGAAGGAGG + Intronic
941227192 2:162864932-162864954 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
941759669 2:169227967-169227989 GTGGAGCAGCTGAGAGAAGAAGG - Intronic
943297895 2:186161218-186161240 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
944810930 2:203327499-203327521 ATGTAACAGCCCTGTGAAGAAGG + Intergenic
945035162 2:205698062-205698084 ATGTAGCAGCTGTGGAAATGGGG - Intronic
945327754 2:208502234-208502256 TTGCAGCAGCTTTGAGAGGAAGG + Intronic
945447842 2:209959422-209959444 ATGTAGCAGCTGTGAGAAGAGGG - Intronic
945593911 2:211768377-211768399 CTAGAGGAGCTGTGAGAAGAGGG - Intronic
946109493 2:217402013-217402035 TTGGAGCAGCGGTGAGAAGTTGG + Intronic
946760557 2:222989246-222989268 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
946995325 2:225384423-225384445 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
947052010 2:226056106-226056128 ATGTAGTAGCTGTGAGACTTTGG - Intergenic
947141268 2:227021325-227021347 AAGTAGGAGCTGTTAGAGGAGGG - Intronic
948221045 2:236269981-236270003 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
948238349 2:236407678-236407700 ATGCAGCAGAGGTGAGGAGAAGG - Intronic
1169552300 20:6713611-6713633 ATGTTGCAGGTGTGGGAAAAGGG + Intergenic
1169593920 20:7176726-7176748 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1170360219 20:15537782-15537804 TTGTAAGAGTTGTGAGAAGAAGG - Intronic
1170591567 20:17775707-17775729 ATGTTGCAGCTGAGAGGTGAAGG - Intergenic
1170605166 20:17870150-17870172 AGTTCGCAGCTGTGAGGAGATGG - Intergenic
1172534633 20:35664100-35664122 GTGTAGCAGTTTTGAGAAGCCGG - Intronic
1173562911 20:44019053-44019075 ATGTAGCAGGTGTCTGAAAAAGG + Intronic
1175195340 20:57239537-57239559 ATAGTGGAGCTGTGAGAAGAGGG - Intronic
1176779974 21:13182291-13182313 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1177197582 21:17919185-17919207 CTAGTGCAGCTGTGAGAAGAGGG - Intronic
1177222979 21:18218116-18218138 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1177312322 21:19413381-19413403 TTATTGGAGCTGTGAGAAGAGGG + Intergenic
1177473121 21:21584256-21584278 CTACAGGAGCTGTGAGAAGAGGG + Intergenic
1177739283 21:25134606-25134628 TTGTAGCTGCTGTGAGCAGTGGG + Intergenic
1177977627 21:27871317-27871339 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1178046151 21:28696618-28696640 TTAGAGGAGCTGTGAGAAGAAGG - Intergenic
1178921060 21:36738587-36738609 AAGTGGCAGCTGTGGGAGGAGGG - Intronic
1179065166 21:38017977-38017999 CTTGTGCAGCTGTGAGAAGAGGG + Intronic
1181007027 22:20018484-20018506 ATGAGGTAACTGTGAGAAGAGGG - Intronic
1181633060 22:24161524-24161546 AAGTAGCAGCTGAGAGAAGCAGG - Intronic
1181930352 22:26395970-26395992 ATGTACCAGCTGTGTGAACCTGG - Intergenic
1184157659 22:42678916-42678938 ATAGAGCAGCTGTGAGAAGAGGG + Intergenic
949254525 3:2030066-2030088 ATGTGGCAGCCATGTGAAGATGG + Intergenic
950123576 3:10497819-10497841 CCGGAGCAGCTGTGAGAAGTCGG - Intronic
950589350 3:13925029-13925051 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
951073164 3:18356648-18356670 AATTAGCAGCTGAGAGATGAAGG - Intronic
951126987 3:18996030-18996052 GTGGTGGAGCTGTGAGAAGAGGG - Intergenic
951265582 3:20562021-20562043 AAGTAGAAGATATGAGAAGACGG - Intergenic
953118764 3:40018685-40018707 AGGTAGAAGCTGTGAGAGGAAGG - Intronic
953456577 3:43047108-43047130 CTGATGGAGCTGTGAGAAGAGGG + Intronic
956149395 3:66225111-66225133 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
957012899 3:75028328-75028350 AAGGTGGAGCTGTGAGAAGAAGG - Intergenic
957145020 3:76412849-76412871 CTAGTGCAGCTGTGAGAAGAGGG - Intronic
957840972 3:85668764-85668786 ATTTATCAGCAGTGTGAAGATGG + Intronic
957873145 3:86112888-86112910 ATGGTGGAGCTGTGAGAAGAGGG + Intergenic
957953124 3:87149994-87150016 CTATTGGAGCTGTGAGAAGAAGG - Intergenic
958042639 3:88244926-88244948 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
958583946 3:96061760-96061782 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
958710258 3:97709081-97709103 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
959788434 3:110329140-110329162 ATGGGAGAGCTGTGAGAAGAGGG + Intergenic
959815673 3:110670937-110670959 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
960492415 3:118333447-118333469 CTACTGCAGCTGTGAGAAGATGG + Intergenic
961941402 3:130641117-130641139 AAGAAGCAGCTGTGATAATAGGG + Intronic
962031180 3:131601909-131601931 GTGTACCAGCTGTGAGACGTTGG + Intronic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
962421558 3:135233589-135233611 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
962426369 3:135272175-135272197 ACGTAGGAGCTCAGAGAAGAGGG + Intergenic
962461046 3:135612899-135612921 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
963515760 3:146306325-146306347 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
963996551 3:151716736-151716758 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
964320555 3:155492134-155492156 ATGGATCAGCTCTGAGAGGAAGG + Intronic
965074963 3:163964229-163964251 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
965395069 3:168152980-168153002 CTATTGAAGCTGTGAGAAGAGGG + Intergenic
965450760 3:168834801-168834823 GTGAAGAAGCTGGGAGAAGAGGG - Intergenic
965931069 3:174043788-174043810 CTACTGCAGCTGTGAGAAGAGGG - Intronic
966733322 3:183168575-183168597 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
966742017 3:183242730-183242752 TTGGTGGAGCTGTGAGAAGAGGG + Intronic
967023126 3:185540198-185540220 ATGTGGGACCTCTGAGAAGATGG - Intronic
967208421 3:187145238-187145260 CTAGTGCAGCTGTGAGAAGAGGG - Intronic
967609191 3:191483437-191483459 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
967633922 3:191778629-191778651 CTGGTGGAGCTGTGAGAAGACGG + Intergenic
968612699 4:1564336-1564358 AGGAAGAGGCTGTGAGAAGACGG + Intergenic
968821413 4:2854966-2854988 ATGTGGCAGCCATGAGAAGCTGG - Intronic
969108008 4:4822544-4822566 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
970361288 4:15311059-15311081 TTAGTGCAGCTGTGAGAAGAGGG + Intergenic
970965443 4:21923073-21923095 GGGTGGCAGCTGTGAGAAGGAGG - Intronic
971067823 4:23054564-23054586 TTGTAGCAGCTTTGTGAAGATGG + Intergenic
971129769 4:23794632-23794654 ATTTAGCAGTTTTGAAAAGAAGG + Exonic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971748676 4:30618092-30618114 ATATAGGAGCTGTGAGAAACAGG - Intergenic
971948714 4:33315540-33315562 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
971969582 4:33604462-33604484 CTAGTGCAGCTGTGAGAAGATGG - Intergenic
972286103 4:37649968-37649990 ATTTAGCAGCTGTGTGACAATGG + Intronic
972976664 4:44644008-44644030 ACAGTGCAGCTGTGAGAAGAGGG + Intronic
973035172 4:45397083-45397105 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
974476557 4:62388999-62389021 AAAAAGCAGCTTTGAGAAGAGGG - Intergenic
974614707 4:64266421-64266443 CTACTGCAGCTGTGAGAAGAGGG - Intergenic
974806140 4:66882986-66883008 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
975921739 4:79398794-79398816 TTGTAACAGCTGTGAGAGGTAGG + Intergenic
976220218 4:82750970-82750992 ATGTAAGTGCTGTGAGAGGAGGG - Intronic
976318594 4:83685956-83685978 ATGAAGAAGGTGTGAGAAGGAGG - Intergenic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
977060572 4:92253710-92253732 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
977378354 4:96237604-96237626 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
977545087 4:98367462-98367484 ATAATGGAGCTGTGAGAAGAGGG + Intronic
978044266 4:104107037-104107059 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
978877557 4:113660122-113660144 ATCTAGAAGCAGTGAGAAAAGGG - Intronic
978921053 4:114183427-114183449 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
979122475 4:116920791-116920813 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
979966921 4:127086818-127086840 CTAGAGGAGCTGTGAGAAGAAGG + Intergenic
979974941 4:127184872-127184894 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
980422809 4:132585606-132585628 CTGGTGGAGCTGTGAGAAGAAGG + Intergenic
981191705 4:141872234-141872256 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
981643069 4:146967445-146967467 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
982618870 4:157678328-157678350 CTGGTGGAGCTGTGAGAAGAAGG - Intergenic
982766950 4:159359427-159359449 TAATAGCAGCTGTGAGCAGATGG - Exonic
982812207 4:159840029-159840051 ATTTGGCAGCTGTGTGTAGATGG + Intergenic
982923445 4:161304956-161304978 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
983083418 4:163414884-163414906 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
983431756 4:167659719-167659741 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
983772297 4:171565861-171565883 AAGCAGGAGCTCTGAGAAGATGG + Intergenic
985079970 4:186254766-186254788 ATGTAGCATATGTAAGAAGGTGG + Intronic
985132723 4:186755504-186755526 ATGTAACGGCTGTTAGAATATGG - Intergenic
986517654 5:8580959-8580981 ATGTGGCAGGTGTGAGAAGAAGG - Intergenic
987512389 5:18856657-18856679 TAGTTGGAGCTGTGAGAAGAAGG + Intergenic
988603071 5:32657149-32657171 ATAGTGGAGCTGTGAGAAGACGG - Intergenic
988686638 5:33531520-33531542 ATGTACCAGCTGTGTGATGTTGG - Intronic
988775024 5:34469615-34469637 AGGTAGCACCTGGGAGAAGGAGG + Intergenic
989966906 5:50475404-50475426 CTGGTGAAGCTGTGAGAAGAAGG + Intergenic
990120950 5:52450734-52450756 ATGTAGCTGCAGAGAGAAAAGGG - Intergenic
990794550 5:59525075-59525097 ATAGTGGAGCTGTGAGAAGAGGG + Intronic
992461009 5:76960267-76960289 AACCAGCAGCTGTGAGAACAGGG + Intronic
992465661 5:77001249-77001271 AGGAAGAAGCTGTGGGAAGAGGG - Intergenic
993293844 5:86109298-86109320 CTGGTGCAGCTGTGAGAAGAGGG + Intergenic
993377452 5:87165915-87165937 ATGTAGTACCTGTGGGATGATGG + Intergenic
994474526 5:100250055-100250077 CTCGTGCAGCTGTGAGAAGAAGG + Intergenic
994900397 5:105762563-105762585 CTGGGGGAGCTGTGAGAAGAGGG - Intergenic
994905715 5:105839220-105839242 AAGTAGGAGCTGTGAGAAGAGGG - Intergenic
995429142 5:112054976-112054998 TTGGTGGAGCTGTGAGAAGAGGG + Intergenic
995701406 5:114939402-114939424 ATGGTGGAGCTGTGAGAAAAGGG + Intergenic
996209544 5:120789940-120789962 CTGAAGGAGCTGTCAGAAGAAGG - Intergenic
996303218 5:122014365-122014387 ATGTAGCAGCAGTGAGTCAAAGG - Intronic
997022010 5:130013315-130013337 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
997088297 5:130826842-130826864 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
997250559 5:132385739-132385761 TAGCAGTAGCTGTGAGAAGATGG + Intronic
997669462 5:135658548-135658570 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
997748827 5:136325368-136325390 AAGTAGCTGATGTGAGAAGTAGG + Intronic
997893957 5:137699327-137699349 ATGGAGTAACAGTGAGAAGAAGG + Intronic
998382903 5:141738265-141738287 CTGGAGCAGCTGTGCCAAGATGG + Intergenic
998487731 5:142517556-142517578 CTATAGGAGCTGTGAGAGGAGGG + Intergenic
998727117 5:145030313-145030335 AAGTAGCTGGTGAGAGAAGAAGG + Intergenic
1000102187 5:158026623-158026645 ATGGAGCAGGAGGGAGAAGAGGG - Intergenic
1000548824 5:162634004-162634026 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1000608080 5:163345422-163345444 ATGCTGCAGCTGTTAGAAGCTGG - Intergenic
1000768300 5:165318978-165319000 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1000947232 5:167437038-167437060 CTAGTGCAGCTGTGAGAAGAGGG + Intronic
1001654614 5:173340032-173340054 ATGTAGCAGGATTGAGAAGTGGG + Intergenic
1001956952 5:175854171-175854193 AAGGAGGAGCTGTGAGAAGTGGG - Intronic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1003160488 6:3630119-3630141 ATGGAGGCGATGTGAGAAGATGG + Intergenic
1003477910 6:6501811-6501833 CTGCAGCAGCTGACAGAAGATGG + Intergenic
1003740174 6:8927914-8927936 ATGTAAGCTCTGTGAGAAGACGG - Intergenic
1004256212 6:14067222-14067244 ATGTAGTAGCTGTCAAAATAAGG + Intergenic
1004805685 6:19201614-19201636 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1005783443 6:29217814-29217836 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1005983026 6:30851928-30851950 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1006314326 6:33280982-33281004 ATGTACCTGGTGAGAGAAGAGGG + Exonic
1007889330 6:45271695-45271717 TTGGTGGAGCTGTGAGAAGAGGG + Intronic
1007933674 6:45714629-45714651 ATTTAGCAGCTGTCAGAAGTTGG - Intergenic
1008057700 6:46962292-46962314 GTGAAGCAGCTGTGAGAACCCGG - Intergenic
1008348049 6:50453899-50453921 ATGTAAGAGCTGTAAGAAAAAGG + Intergenic
1008499835 6:52169957-52169979 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1008820948 6:55630015-55630037 ATAGTGGAGCTGTGAGAAGAAGG + Intergenic
1009184752 6:60561519-60561541 ATGGAGCTGCTGTAAGTAGATGG - Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009631680 6:66208664-66208686 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1010324056 6:74544732-74544754 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
1010330957 6:74623595-74623617 CTATTGCAGCTGTGAGAAGAGGG + Intergenic
1010650997 6:78455438-78455460 CTGATGGAGCTGTGAGAAGAGGG - Intergenic
1010835859 6:80586793-80586815 CTAGAGGAGCTGTGAGAAGAAGG + Intergenic
1011041193 6:83032106-83032128 CTGGTGGAGCTGTGAGAAGAGGG + Intronic
1012068191 6:94577163-94577185 TTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1013915893 6:115336495-115336517 CTAGAGAAGCTGTGAGAAGAAGG + Intergenic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1014761134 6:125357953-125357975 AGGAAGCAGGTGAGAGAAGATGG + Intergenic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015550753 6:134410150-134410172 ATGCAAGAGCTGTGAGAACATGG - Intergenic
1015741945 6:136465796-136465818 ATCCAGCAACTGTTAGAAGATGG - Intronic
1015866686 6:137734175-137734197 AGGTAGCAGATGTAGGAAGAAGG - Intergenic
1016118044 6:140312948-140312970 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1016284931 6:142462585-142462607 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1016419978 6:143873438-143873460 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1016512991 6:144864175-144864197 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1017860521 6:158393370-158393392 CTGGTGAAGCTGTGAGAAGAGGG - Intronic
1017955644 6:159175628-159175650 ATGTAGCCTCTGTTACAAGATGG + Intronic
1018059388 6:160078790-160078812 TTGTGGCAGCTTTGGGAAGAGGG + Intronic
1018721612 6:166577277-166577299 CTGGTGGAGCTGTGAGAAGAAGG + Intronic
1020511398 7:9061443-9061465 ATGTAGGAGCTGTGAAAACTGGG + Intergenic
1020537827 7:9424123-9424145 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1020810675 7:12846548-12846570 ATCATGGAGCTGTGAGAAGAGGG - Intergenic
1021136319 7:16968793-16968815 ATGCAGCAGCTGTGCAAAGGAGG + Intergenic
1021299220 7:18950933-18950955 ATGTAACAGGTGTGTGAGGATGG - Intronic
1023208455 7:37776485-37776507 CTAGAGGAGCTGTGAGAAGAGGG + Intronic
1024487207 7:49932194-49932216 CTATTGGAGCTGTGAGAAGAGGG + Intronic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1026474430 7:70722349-70722371 ATGTAGCTGCTTTGGGAAGAGGG + Intronic
1027369611 7:77494363-77494385 CTAGAGGAGCTGTGAGAAGAAGG + Intergenic
1027481985 7:78709394-78709416 ATGTAGAAGCTTAGAAAAGAAGG - Intronic
1027977622 7:85179213-85179235 ATAGTGGAGCTGTGAGAAGAGGG + Intronic
1027991029 7:85361036-85361058 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
1028099113 7:86798184-86798206 ATAGTGGAGCTGTGAGAAGAGGG + Intronic
1028668321 7:93372250-93372272 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1028678292 7:93494036-93494058 ATGTAGCCTCTGAGAGAAGAAGG + Intronic
1028935548 7:96459798-96459820 ATGTAGCAGCTAAGAGTAGAGGG + Intergenic
1029939429 7:104464387-104464409 ATAGTGGAGCTGTGAGAAGAGGG - Intronic
1030295893 7:107926713-107926735 AATAAGCAGCTGTGCGAAGAGGG + Intronic
1030402789 7:109073733-109073755 ATGAAGCAGATGTCAGGAGATGG + Intergenic
1031182200 7:118433117-118433139 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
1031608266 7:123794843-123794865 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
1031618225 7:123905564-123905586 CGGTTGGAGCTGTGAGAAGAGGG - Intergenic
1031806792 7:126316900-126316922 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1032494779 7:132352685-132352707 ATGCTGCAGCTTTGAGAAGTTGG - Intronic
1033031563 7:137832203-137832225 CTATTGAAGCTGTGAGAAGAGGG - Intronic
1033870584 7:145750011-145750033 ATGTAACTGCTGTTAGAATATGG + Intergenic
1034032604 7:147784900-147784922 ATGCAGTGGCTGTGGGAAGAGGG + Intronic
1035732741 8:1864447-1864469 ATTCAGCAGGTGTGGGAAGACGG - Intronic
1036914662 8:12793514-12793536 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1038558394 8:28545627-28545649 ATGTAGCTGCAGTCAGATGATGG - Intronic
1039071407 8:33652293-33652315 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
1039168528 8:34714525-34714547 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1040094931 8:43433963-43433985 CTATTGGAGCTGTGAGAAGAGGG + Intergenic
1041076158 8:54171978-54172000 ATGGAGGAGCTGTCAGAATAGGG - Intergenic
1041825896 8:62096026-62096048 CTAGAGGAGCTGTGAGAAGAGGG - Intergenic
1041989325 8:63966923-63966945 ATGTAGCATCTGTGATTAGAAGG - Intergenic
1042432769 8:68727477-68727499 ATAGTGGAGCTGTGAGAAGAGGG - Intronic
1042954769 8:74238045-74238067 ATGGAGCAGATCTGAAAAGATGG - Intronic
1043241192 8:77937849-77937871 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1044851470 8:96432823-96432845 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
1044946869 8:97397469-97397491 ATGTTGCAGCTGAGAGCTGAGGG - Intergenic
1045079062 8:98604482-98604504 CTGGTGGAGCTGTGAGAAGAGGG - Intronic
1045884383 8:107078684-107078706 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1046158678 8:110330445-110330467 ATGTAGAAGTGGTGAGAAGGTGG + Intergenic
1046247033 8:111577562-111577584 ATGTAGCAGTTATCAGTAGAAGG + Intergenic
1046506718 8:115146492-115146514 ATAGTGGAGCTGTGAGAAGAGGG - Intergenic
1046767693 8:118088089-118088111 GTGCAGCAGCCGGGAGAAGAAGG - Intronic
1047128761 8:121993978-121994000 ATTTGGCTGCTGTGACAAGATGG - Intergenic
1047263605 8:123284678-123284700 ATGCAACAGCTGTGAGGTGAAGG + Intergenic
1048669113 8:136696244-136696266 CTAGAGGAGCTGTGAGAAGAAGG + Intergenic
1049307038 8:141909502-141909524 CTGTAACAGCTATGAGAAGACGG - Intergenic
1050016195 9:1236829-1236851 ATTTATCAGCAGTGAGAAAATGG - Intergenic
1050568076 9:6908342-6908364 GTGTAGCTGCTGTGCGAAGTGGG + Intronic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1051925245 9:22317194-22317216 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1052522251 9:29563112-29563134 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
1052986255 9:34490322-34490344 AGGAATCAGCTGTGAGAAGGTGG - Intronic
1053780315 9:41600213-41600235 CTAATGCAGCTGTGAGAAGAGGG + Intergenic
1054168257 9:61810370-61810392 CTAATGCAGCTGTGAGAAGAGGG + Intergenic
1054669271 9:67770448-67770470 CTAATGCAGCTGTGAGAAGAGGG - Intergenic
1055094309 9:72395253-72395275 ATGCAGCAGCTGTGAAATGGTGG - Intergenic
1055713301 9:79088861-79088883 CTAGTGCAGCTGTGAGAAGAGGG - Intergenic
1056797425 9:89668303-89668325 ATGCAGCCTCTGTGAGAAGGTGG - Intergenic
1057325677 9:94061411-94061433 CTAGTGCAGCTGTGAGAAGAAGG - Intronic
1058101832 9:100925147-100925169 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1058368834 9:104240905-104240927 ATGTAGCAGCTCTGGCAAGATGG + Intergenic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1059570059 9:115424949-115424971 CTGCTGGAGCTGTGAGAAGAAGG - Intergenic
1060346531 9:122821755-122821777 AGGAAGCAGCTGTGAGCAGCAGG + Intronic
1061826375 9:133260831-133260853 CTCCAGCTGCTGTGAGAAGAAGG + Intronic
1062157850 9:135063698-135063720 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1185744653 X:2562815-2562837 TGGCAGCAGCTGTGAAAAGATGG - Intergenic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1186247338 X:7628418-7628440 ATGCAGAAGTTGTGACAAGATGG - Intergenic
1186429439 X:9492142-9492164 ATGGAGTAGTTGTGAGACGAAGG + Intronic
1186598974 X:11015829-11015851 ATGGGGCAGCTGGCAGAAGAGGG - Intergenic
1186620403 X:11235010-11235032 CTAGAGGAGCTGTGAGAAGAGGG - Intronic
1186679279 X:11854872-11854894 CTGGTGGAGCTGTGAGAAGAAGG - Intergenic
1186704597 X:12128127-12128149 GGGTTGGAGCTGTGAGAAGAAGG - Intergenic
1187548287 X:20275111-20275133 ATGTGGGAGGTGCGAGAAGAAGG - Intergenic
1187927614 X:24264314-24264336 ATAAAGCAGGTGGGAGAAGATGG - Intergenic
1188033918 X:25295707-25295729 ATGTAGCAGCAGTGTACAGAGGG - Intergenic
1188391089 X:29620648-29620670 ATGCAGCAGCTGTCAGTTGATGG + Intronic
1189028797 X:37428713-37428735 ATAGTGGAGCTGTGAGAAGAGGG - Intronic
1189234258 X:39475628-39475650 ATCTAGCAGCTGTGTGTAGGAGG + Intergenic
1190139871 X:47833434-47833456 ATGTAGCAGTATTGAGAAGTAGG + Intergenic
1190466182 X:50726868-50726890 CTATTGGAGCTGTGAGAAGAGGG + Intronic
1190741460 X:53291702-53291724 ATGTGGCAGCTGTGGGGAGGGGG - Intronic
1190772561 X:53527312-53527334 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1192511869 X:71725448-71725470 ATGAAGCAAATGTGAGAAAATGG - Intergenic
1192514828 X:71756057-71756079 ATGAAGCAAATGTGAGAAAATGG + Intergenic
1192603661 X:72491077-72491099 AGAAAGCAGCTGTGAGAAGGAGG + Intronic
1192887183 X:75347838-75347860 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1193127415 X:77884692-77884714 TTGTTGCAGCTGGGAGAGGAGGG - Intronic
1193153482 X:78148352-78148374 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1193501068 X:82275675-82275697 CTATTGGAGCTGTGAGAAGAGGG - Intergenic
1193678198 X:84483216-84483238 ATAGTGGAGCTGTGAGAAGAGGG - Intronic
1194756339 X:97743536-97743558 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1195525888 X:105889460-105889482 CTGGTGCAGCTGTGAGAAGAGGG - Intronic
1195822115 X:108956747-108956769 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1196458533 X:115906603-115906625 ATGTACCAGTTGTGAGAACTAGG - Intergenic
1196930383 X:120675943-120675965 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1197348992 X:125359354-125359376 CTAGTGCAGCTGTGAGAAGAGGG + Intergenic
1197366738 X:125572867-125572889 CTGGTGGAGCTGTGAGAAGAGGG - Intergenic
1197524804 X:127547962-127547984 CTAGAGGAGCTGTGAGAAGAGGG + Intergenic
1198650391 X:138857277-138857299 ATGTTTCAGCTGTGAAAAGCAGG + Intronic
1198775307 X:140172955-140172977 ATAGTGGAGCTGTGAGAAGAGGG + Intergenic
1199072728 X:143497862-143497884 CTGGTGGAGCTGTGAGAAGAAGG - Intergenic
1199338024 X:146642463-146642485 CTGGTGGAGCTGTGAGAAGAGGG + Intergenic
1199400740 X:147395637-147395659 CTGCTGGAGCTGTGAGAAGAGGG + Intergenic
1199739092 X:150715589-150715611 ATGAAGCTGCTGTTAGGAGAAGG - Intronic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1200231677 X:154446906-154446928 AGGTCTCAGCTGTGAGAACAAGG + Intronic