ID: 945447886

View in Genome Browser
Species Human (GRCh38)
Location 2:209959724-209959746
Sequence CTGTGTTCACACTTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 349}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945447886_945447899 22 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447899 2:209959769-209959791 GTGTGTTGGGTTGAGAGTGGGGG 0: 1
1: 0
2: 8
3: 59
4: 579
945447886_945447894 8 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447894 2:209959755-209959777 ATGTGTCTGAATGTGTGTGTTGG 0: 1
1: 2
2: 64
3: 534
4: 4533
945447886_945447896 19 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447896 2:209959766-209959788 TGTGTGTGTTGGGTTGAGAGTGG 0: 1
1: 0
2: 14
3: 174
4: 1370
945447886_945447895 9 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447895 2:209959756-209959778 TGTGTCTGAATGTGTGTGTTGGG 0: 1
1: 2
2: 81
3: 1732
4: 8926
945447886_945447897 20 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447897 2:209959767-209959789 GTGTGTGTTGGGTTGAGAGTGGG 0: 1
1: 0
2: 10
3: 71
4: 610
945447886_945447898 21 Left 945447886 2:209959724-209959746 CCCTGCCCCAAGTGTGAACACAG 0: 1
1: 0
2: 4
3: 30
4: 349
Right 945447898 2:209959768-209959790 TGTGTGTTGGGTTGAGAGTGGGG 0: 1
1: 0
2: 8
3: 98
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945447886 Original CRISPR CTGTGTTCACACTTGGGGCA GGG (reversed) Intronic
901031404 1:6309064-6309086 CAGTGTGCACACCTGGGTCAAGG - Intronic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
905443527 1:38009545-38009567 CTGTGTTCTCACTAGGGGGAAGG - Intronic
906689663 1:47784278-47784300 CTGAGTTCACATTTGGGGGCAGG + Intronic
907942670 1:59104571-59104593 CTGAGTTCACTCTTGGTTCAGGG + Intergenic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
910672336 1:89785780-89785802 ATGTGTTTCTACTTGGGGCAAGG + Intronic
910805123 1:91182054-91182076 CTGTGTTCTCACTTGGCAGAAGG + Intergenic
913191327 1:116415860-116415882 CTGTGGTCACACTTGGGGGAGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915081656 1:153356905-153356927 CTGTGTTCCCACAGTGGGCAGGG + Intergenic
915680217 1:157574376-157574398 CAGTTTTAACACTTGGGGCATGG + Exonic
916017183 1:160760462-160760484 CTGTGTTCTCACATGGTGAAAGG - Intergenic
916812759 1:168319877-168319899 CTGTGTTCACACTTGGGAGGAGG + Intergenic
921065513 1:211619764-211619786 CTCTGTTCACACTGGCGGCTTGG + Intergenic
921287825 1:213624745-213624767 CCGTGTTCTCACTTGGTGGAAGG + Intergenic
921781843 1:219174270-219174292 CTCTGTTTAAACTTGGGGCGAGG - Intronic
923017802 1:230140287-230140309 CTGTGTACACACTACTGGCAGGG - Intronic
923706181 1:236346625-236346647 CTTTGCACACACTTGGGGGAGGG + Intergenic
923915820 1:238503477-238503499 CTATGTTCTCACTGGAGGCAAGG + Intergenic
924282610 1:242453204-242453226 CTGTGTCCTCACCTGGGGGAAGG - Intronic
1063464161 10:6232316-6232338 CTGTGATCAGAAGTGGGGCAGGG + Intronic
1064092003 10:12393708-12393730 ATGTGTCCAAACTTGAGGCATGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1065279665 10:24122100-24122122 CTATGTTCACACCTGGGTGATGG - Intronic
1065356675 10:24848943-24848965 CTGTCTTCACATTTAGGACAGGG + Exonic
1065361033 10:24889178-24889200 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1065774093 10:29103223-29103245 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1066298526 10:34076646-34076668 CTGTGTCCTCACTTGGTGTAAGG - Intergenic
1067230109 10:44400116-44400138 CTGTGTTCACACTCGGGGACAGG - Intergenic
1067781303 10:49209335-49209357 CTGTGCTGTCACTGGGGGCAAGG - Intergenic
1068274750 10:54779635-54779657 CTGTGTTCACATTTTGGCTAGGG - Intronic
1068848533 10:61708578-61708600 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1069430131 10:68327288-68327310 CGATGGTCACACTGGGGGCAGGG - Intronic
1072820157 10:98548653-98548675 CTGTTTTCAACCTTGGGGTAAGG + Intronic
1073679758 10:105689993-105690015 CTGTTGTTACACTGGGGGCAGGG + Intergenic
1073821611 10:107270873-107270895 CTGTGTTCTCACATGGGAGAAGG + Intergenic
1074315775 10:112360442-112360464 CTGTGATCACACTGGGGGAGAGG + Intergenic
1075745538 10:124724765-124724787 TTGTGTTCTCCCTTGGGGAATGG + Intronic
1076671014 10:132121146-132121168 CTCTGCTGACACTTGGGGCAGGG - Intronic
1079460595 11:20674728-20674750 CTGTGTTCTCATTTGGGGGTGGG + Intronic
1080025050 11:27604617-27604639 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1081466632 11:43324977-43324999 CTCTGGTCAAATTTGGGGCATGG - Intronic
1082920753 11:58490802-58490824 CTGTAATTACACATGGGGCAGGG + Intergenic
1083706714 11:64521661-64521683 CTGTGTTCTCTCTAGAGGCAGGG - Intergenic
1083933047 11:65856502-65856524 CTGGGTTCACATTTTGGTCAAGG - Intronic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1088489973 11:110377592-110377614 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1089378366 11:118011040-118011062 CTTTCTTCACCCTTGGGGCCTGG - Intergenic
1089697966 11:120227451-120227473 CTGTGTCCTCACTAAGGGCAGGG - Intronic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1090895168 11:130965340-130965362 CTGTGCTCACACCTGGGTGATGG - Intergenic
1093763085 12:22932230-22932252 CTGTGTCCTCACATGGGGAAAGG - Intergenic
1094090371 12:26643099-26643121 CTGTGTCCTGACTTGGGGAAAGG - Intronic
1094478559 12:30861654-30861676 CTGTGTTCTCACATGGCGGAAGG + Intergenic
1095279786 12:40336510-40336532 CTGTGTTGACAGTAGGGGAAGGG + Intronic
1096072186 12:48781590-48781612 CAGTGTTCACACCTGGGGGCAGG - Intronic
1096857534 12:54495461-54495483 CTGTGTTCACTATTTGGGCATGG - Intergenic
1096944768 12:55392345-55392367 GTGTGCTCACGCTTGGGGCACGG - Intergenic
1097687957 12:62708815-62708837 CTGTGCTGACACTTGGGTGATGG - Intronic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1099707836 12:86180056-86180078 CTGTGTGCACCCTTGGGACTTGG + Intronic
1100779325 12:98007509-98007531 CTGTGTTCTCACTTGTGGAGGGG - Intergenic
1101490797 12:105207652-105207674 CAGAGTCAACACTTGGGGCAAGG + Intronic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1101842206 12:108336084-108336106 CTTTGTTCACACTGGGGTCTTGG - Intronic
1103262690 12:119602057-119602079 GTATGGTCAGACTTGGGGCATGG - Intronic
1103850576 12:123930335-123930357 CTGTGTGCACCCTGGGGGCCCGG - Exonic
1104414714 12:128588722-128588744 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1105027539 12:132859039-132859061 CCGTGTTCACCCTTGGCTCACGG - Intronic
1105658805 13:22470561-22470583 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG + Intronic
1108606073 13:52039997-52040019 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1109071423 13:57773743-57773765 CTGTGTCCCCACATGGGGCCAGG + Intergenic
1109130199 13:58575027-58575049 CTGTGTGCAGCCTTGGGACATGG - Intergenic
1112433726 13:99375490-99375512 CTGAGCTCACACTGGGTGCAGGG - Intronic
1112462982 13:99619279-99619301 CTGTGTCCTCACATGGCGCAGGG - Intronic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1113496953 13:110738623-110738645 CTCTGTGCAGCCTTGGGGCATGG + Intergenic
1114430998 14:22660473-22660495 CTGTGTTCTCACATGGCGGAAGG + Intergenic
1115311591 14:31984374-31984396 CTGGGTTCACTCTTGGGTCTTGG + Intergenic
1116250685 14:42479219-42479241 CTGTGTCCACACGTGGTGGAAGG - Intergenic
1118177567 14:63456883-63456905 CTGTGTTAATTCTTGGTGCATGG - Intronic
1118612976 14:67555768-67555790 CCGTGTTCACAGTAGGGACATGG + Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1118744905 14:68766748-68766770 CTGTGTGCAGCCTTGGAGCAGGG - Intergenic
1119385603 14:74256579-74256601 CTGTGGTCACACTTGGTGTCTGG + Intronic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1120604552 14:86558424-86558446 CTGTGTTCACATTTTGTGTATGG + Intergenic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121734921 14:96211503-96211525 GTGTGCTCACACGTGGGCCAGGG + Intronic
1122282760 14:100633843-100633865 CTGAGTGCCCATTTGGGGCAAGG + Intergenic
1122833499 14:104417747-104417769 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1123628898 15:22247260-22247282 CTCTGTGCAGTCTTGGGGCATGG + Intergenic
1123986400 15:25650211-25650233 CTGTATTCTCACATGGGGAAAGG + Intergenic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124412240 15:29446091-29446113 CTGTGTCCTCACTTGGTGGAAGG - Intronic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1126101791 15:45122301-45122323 CTGTTTCCAGACTTGGGGGAGGG + Intronic
1126512617 15:49497338-49497360 CTGTGTCCAGACTGGGGGTAAGG + Intronic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1128301624 15:66569748-66569770 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1128881415 15:71246501-71246523 GTGTGATCACCCTTGGGTCATGG + Intronic
1129034291 15:72640345-72640367 GGGTGCTCACACATGGGGCACGG - Intergenic
1129215591 15:74096871-74096893 GGGTGCTCACACATGGGGCACGG + Intergenic
1129233646 15:74210546-74210568 CAGTGGTCACACTTGGGGGAGGG + Intronic
1129555569 15:76504878-76504900 CTGTGTTCACATTTGTGGCTGGG + Exonic
1129732727 15:77941200-77941222 GGGTGCTCACACATGGGGCACGG + Intergenic
1129853755 15:78810533-78810555 GCGTCTTCACACTTGGGGAAGGG + Intronic
1130034225 15:80342749-80342771 CTGGGTCCACACTTGAGGGATGG - Intergenic
1130562556 15:84970091-84970113 CTGTGATTACACTTGGGACAGGG + Intergenic
1131788147 15:95935036-95935058 TTGTGTTCTCACTTGGTGGAAGG - Intergenic
1132084805 15:98899430-98899452 CTGTGTGCTCACTTGGTGTAAGG - Intronic
1132248871 15:100318471-100318493 CTGTGTCCTCACCTGGGGGAAGG - Intronic
1132615510 16:839532-839554 GTGGGTCCACACTGGGGGCAGGG - Intergenic
1132623674 16:880027-880049 CTGTGTTCTCAAGTTGGGCACGG - Intronic
1133663713 16:7944445-7944467 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1134827416 16:17295725-17295747 TTGTTGTCACACTTGGGGAAGGG + Intronic
1135097637 16:19577788-19577810 CTGTGTTTTCACTTGGTGGAAGG - Intronic
1135881252 16:26259793-26259815 CTGTTTTCTCACTGAGGGCAGGG + Intergenic
1137386745 16:48049069-48049091 CTGTGTCCTCACTTGGCGGAAGG - Intergenic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1138422369 16:56907676-56907698 CTGTGTCCTCACTTGGCGGAGGG + Intronic
1138854550 16:60673029-60673051 ATGTTTTCACACTTGTGACATGG + Intergenic
1138973260 16:62171441-62171463 CTGTGTCCTCACATGGGGCAAGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140217375 16:73019439-73019461 GTGTGTTCACACTTGGTGGAAGG - Intronic
1140768637 16:78183178-78183200 CTGTCTCCACACTTAGGGCAAGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142979579 17:3663885-3663907 CTGTGTTCTCTCCTGGGGCCAGG - Exonic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1143524834 17:7466077-7466099 CTTTTTCCACACTGGGGGCAGGG + Exonic
1143958334 17:10693232-10693254 CTGTGTCCATGCTGGGGGCAGGG + Intronic
1145303015 17:21653890-21653912 CTATGTACTCACTTGGGGCCTGG - Intergenic
1145347025 17:22047951-22047973 CTATGTACTCACTTGGGGCCTGG + Intergenic
1146286083 17:31575033-31575055 CTGTGTTCACAGGAGGGGCGTGG - Intronic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1147161229 17:38570589-38570611 ATGTGTTGACACTGGTGGCAGGG - Intronic
1148283749 17:46370054-46370076 CTGTATTCACTCCTGGGCCAGGG + Intergenic
1148305967 17:46587971-46587993 CTGTATTCACTCCTGGGCCAGGG + Intergenic
1150459381 17:65334827-65334849 TTGTGCTCATAGTTGGGGCACGG + Intergenic
1150600669 17:66648144-66648166 CTGTGTCCTCACATGGTGCAAGG + Intronic
1151175557 17:72284988-72285010 AGGTGTTTACACTTGGGGAAGGG + Intergenic
1151464653 17:74276674-74276696 CTCTGTTCTCACTCGGGGCTTGG + Intronic
1152576718 17:81144369-81144391 GGGTGTTCACACCTGGGGCAAGG + Intronic
1153787754 18:8549705-8549727 CTGTGTTCACACTTGGGTGATGG + Intergenic
1155487048 18:26356170-26356192 CTATGTTCTCACTTGGTGGAAGG + Intronic
1155900227 18:31380406-31380428 CTGTGCTCCCACTTGGGGAAGGG - Intronic
1156720145 18:40060147-40060169 CTGTACTCACCCTTGGGGAAGGG - Intergenic
1157510411 18:48267771-48267793 CTGTGTTCTCACGTGGTGTAAGG - Intronic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1160107031 18:75987762-75987784 CTCTGTTGACACTTCGGGCTGGG + Intergenic
1161323408 19:3651739-3651761 CTGTTTTCACACTTGGGACGGGG + Intronic
1161444390 19:4310329-4310351 CTGTCTTCACACCAGGGGCAGGG - Intronic
1162127779 19:8508658-8508680 CTGTTTTCAGTCTTGGGGTAAGG + Intergenic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162717846 19:12645110-12645132 CTGTGGTCCCACTTGGGGCATGG - Intronic
1162779060 19:12997109-12997131 CTGTGGACACACTTGGCACATGG - Intronic
1162935598 19:13980046-13980068 TTCTGTTTACACTTGGGGAAGGG + Intronic
1163205301 19:15798280-15798302 CTGTTTCCACACCTGGGGCATGG - Intergenic
1164565884 19:29325657-29325679 CTGTGTTTTCACTTGGTGCCAGG - Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165454986 19:35905305-35905327 CAGTGTTCACACTTGGGGTAGGG + Intronic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1167317037 19:48770275-48770297 CTGTGTTTCCACTTGGTGAAAGG - Intergenic
1167449659 19:49559780-49559802 CTGTATTCTCACATGGGACATGG - Intronic
1167735075 19:51289408-51289430 CTGTGTCCCCACTTGGTGGAAGG + Intergenic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925114073 2:1363570-1363592 CTGTGTTCACATGTCGGTCATGG - Intronic
925556054 2:5132677-5132699 CTGTGTCCTCACATGGGGGAAGG - Intergenic
926060960 2:9804464-9804486 CTGTGTCCACACTTAGTGGAAGG - Intergenic
927445774 2:23160308-23160330 CTGAGTTCAGACTTGGGGGCAGG + Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
928919838 2:36515084-36515106 CTGTGTTGACTCTTTGGGGAGGG + Intronic
929081579 2:38127492-38127514 CTTTGTGCAGCCTTGGGGCATGG + Intergenic
929256705 2:39818921-39818943 CTGTGTTCTCACATGGTGAAAGG + Intergenic
929316082 2:40480409-40480431 CTGTGTCCACACATGATGCAAGG - Intronic
929829663 2:45336566-45336588 CTGGCTTCACACTGTGGGCAGGG - Intergenic
930157724 2:48122963-48122985 CTGTGTTCTCACTTGCTGGAAGG - Intergenic
930797713 2:55410174-55410196 TTGTGTACACCCTTGGGCCAAGG + Intronic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
933031933 2:77339148-77339170 CTGTGTTCACTTTTGGGTGATGG + Intronic
933470546 2:82717376-82717398 CTGTGTTCTCACATGATGCAAGG - Intergenic
934902703 2:98173246-98173268 AAGTGTTCACACTTCAGGCAAGG + Intronic
935114777 2:100125939-100125961 CTGTGCACACACTTGGGACCAGG + Intronic
935262670 2:101368779-101368801 CTGTGCCCTCACTTGGGGCAAGG - Intronic
935341607 2:102064194-102064216 CTTTGTTCCCACTTGGAGTAGGG + Intergenic
935709682 2:105887026-105887048 GACTCTTCACACTTGGGGCAAGG + Intronic
936857704 2:116980182-116980204 CTGAGCTCACTCTTTGGGCAGGG - Intergenic
938946055 2:136212962-136212984 CTGTGTTCTCACTTGGTAGAAGG + Intergenic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940009898 2:149041549-149041571 TTGTGTTCAGACATGGAGCATGG - Intronic
940471331 2:154104364-154104386 CTGTGCTCACACAGAGGGCAAGG - Intronic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
942539181 2:176997524-176997546 CTGTGTTGACAGTGGGGACAAGG + Intergenic
945303389 2:208235361-208235383 CTGGCTTCACACCTGGGGAAAGG - Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
946876595 2:224135766-224135788 CTTTATTCACATTAGGGGCATGG + Intergenic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
948666028 2:239535495-239535517 CTGTGTGGTCACTTTGGGCAGGG - Intergenic
1169567154 20:6867650-6867672 CAGTGTTCTCACTTGGGACTGGG + Intergenic
1169965157 20:11209058-11209080 GTGTGTTCACAATGGTGGCAGGG - Intergenic
1170428570 20:16258407-16258429 GTGTGTTTACAATTGGGGAAGGG - Intergenic
1171520534 20:25771582-25771604 CTATGTACTCACTTGGGGCCTGG - Intronic
1171556385 20:26084911-26084933 CTATGTACTCACTTGGGGCCTGG + Intergenic
1171950862 20:31420530-31420552 CTGTGTCCTCACATGGGGGAAGG + Intergenic
1172189441 20:33053415-33053437 CTCTGGGCACACTTGGGGGAGGG - Intergenic
1172962478 20:38808246-38808268 CTGTTGCTACACTTGGGGCATGG - Intronic
1174488644 20:50876866-50876888 CTGTGGTCTCACATGAGGCAGGG - Exonic
1174539004 20:51274764-51274786 CTGTGTTCTCACTGGGGGTGGGG + Intergenic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1177236151 21:18392014-18392036 CTGTGTACAGCCTTGGGGCTTGG - Intronic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1177509430 21:22065199-22065221 CTGTGTTCACATTTGTTGTAAGG + Intergenic
1181722360 22:24785697-24785719 CTCTGTCCACACTAGAGGCAGGG - Intergenic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1183965172 22:41437156-41437178 CTGTGTTCACATTGGGGAGATGG - Exonic
1184445689 22:44545540-44545562 CTGTGCTCACTCTGGGTGCAGGG + Intergenic
949527004 3:4914979-4915001 CTGTGTTGTCACTTGGTGGAAGG + Intergenic
949904226 3:8844976-8844998 CTGTGTTCTCACATGGTGAAAGG - Intronic
950650201 3:14402502-14402524 GTGTGTCCGCACTTGGGGCGGGG + Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
952478387 3:33734480-33734502 CTGTGTTCTCACATGGGGTGGGG - Intergenic
955078925 3:55639884-55639906 ATGTTTTCACACTTGGACCAAGG + Intronic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955558535 3:60163676-60163698 CACTGTTCACATTTGGGGCCGGG + Intronic
955812229 3:62803530-62803552 CACTGTTGACACGTGGGGCAAGG - Intronic
956411338 3:68983070-68983092 GTGTGTTCACAGGTGGGGCCTGG - Intronic
956920783 3:73926978-73927000 CTATGGTCACAGTTAGGGCAGGG + Intergenic
958748259 3:98163857-98163879 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
958752046 3:98203198-98203220 CTGTGTTCTCACGTGGTGAAAGG + Intergenic
959064950 3:101646844-101646866 CTGTGTTCTCACATGGCACAAGG + Intergenic
959178918 3:102953900-102953922 CTGTGTTCTCGCTTGGTGGAGGG - Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960593307 3:119386404-119386426 CTGTGTTCTCACATGGGGAAAGG + Intronic
962199048 3:133386448-133386470 CTGTATTCACATTTGTGGAAGGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962646446 3:137445266-137445288 CTCTGTGCAGCCTTGGGGCATGG - Intergenic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
963678521 3:148345419-148345441 TTGTGTCCTCACATGGGGCAAGG - Intergenic
964538728 3:157755899-157755921 CTGTGCACCCACTTAGGGCACGG - Intergenic
964655990 3:159066696-159066718 CGGTGTTGACAGTTTGGGCAGGG + Intronic
964730151 3:159856449-159856471 ATGTGTACATTCTTGGGGCAGGG + Intronic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
966231489 3:177657351-177657373 CTCTGTGCACAATTAGGGCAAGG + Intergenic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
967309635 3:188093862-188093884 GTGTGTGCACACTTAGGTCAAGG + Intergenic
967871335 3:194232198-194232220 CAGTGGTCACCCTTTGGGCAGGG + Intergenic
968253811 3:197247341-197247363 CTGTGCACCCACTTGGGGCGGGG + Intronic
972775819 4:42239531-42239553 CTGTGTCCTCACATGGGGAAAGG - Intergenic
973602819 4:52558758-52558780 CTGTGTTCTCACGTGGTGGAAGG + Intergenic
974365763 4:60946934-60946956 CTGTGTTCTCACATGGTGAAAGG + Intergenic
974556203 4:63451877-63451899 CTGTGCTCTCTCTTGGGGAAGGG + Intergenic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
975239680 4:72043027-72043049 CTGTGTTCAGCCTTGGGACTTGG + Intronic
975557401 4:75677990-75678012 CTGTGTTCTCACATGGTGAAAGG - Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976700106 4:87960373-87960395 CTGTGTTCTCACTTGGTATAAGG + Intergenic
977127361 4:93186999-93187021 CTGTGTCCTCACATGGTGCAAGG + Intronic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
980386047 4:132089039-132089061 CTGTGTGCAGACTTGGGACATGG + Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
981605806 4:146538862-146538884 CTGTGTTCTCACGTGGGAGAAGG + Intergenic
981719845 4:147790189-147790211 CTGTGTCCTCACTTGGGACACGG + Intronic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984523760 4:180831680-180831702 CTGTGTCCTCACATGGGGGAAGG + Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
984905456 4:184621811-184621833 CTGTCTTCTCACTTGGTTCATGG + Intergenic
986028948 5:3877452-3877474 CTGTCTTCTCACCTGGAGCAAGG - Intergenic
987760776 5:22160710-22160732 CTGTGTTCTCACATGGTGAAAGG + Intronic
988925089 5:35981911-35981933 CTCTGTTCAGCCTTGGGGCATGG + Intronic
989954264 5:50338294-50338316 ATGTGTCCTCACTTGGGGGAAGG + Intergenic
990075773 5:51844066-51844088 CTGTGTGCAGCCTTGGGACATGG - Intergenic
990428014 5:55707915-55707937 CTGTGTCCTCACATGGGGGAAGG - Intronic
991895553 5:71394163-71394185 CTGTGTTCTCACATGGTGAAAGG + Intergenic
991953708 5:71971725-71971747 CTGTATTCTCACATGGGGGAAGG + Intergenic
992350642 5:75925340-75925362 CTGTTTACACACTGGGGCCAAGG - Intergenic
993752892 5:91692219-91692241 CTGTGTGCAACCTTGGGACATGG - Intergenic
994208920 5:97066289-97066311 CTATGATCACACTTTGGACAAGG + Intergenic
995143663 5:108762279-108762301 CTTTGCTCACACTGGGGTCAGGG - Intronic
995812922 5:116128306-116128328 CTGTGTTAACAGTTTTGGCATGG + Intronic
995865094 5:116681853-116681875 GTGTTTTCAGACATGGGGCAAGG + Intergenic
996480515 5:123970469-123970491 CTGTGTTCTCACATGGTGAAAGG + Intergenic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
996793432 5:127318132-127318154 TTGTGTTCTCACATGGTGCAAGG - Intronic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
999734229 5:154500616-154500638 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1000701467 5:164456616-164456638 CTGTGTTCGCACATGGTGGAAGG - Intergenic
1001140278 5:169138324-169138346 ATCTGTTCTCACTTGAGGCAAGG - Intronic
1001203228 5:169738156-169738178 CTGTGTTCATGGTTGCGGCATGG + Intronic
1001566591 5:172703485-172703507 CTGAGTCCACACGTGGTGCAAGG + Intergenic
1003187883 6:3849118-3849140 CTGTTTTCACGCTGTGGGCAGGG - Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1004197269 6:13516269-13516291 GTGGGTTGACATTTGGGGCAGGG + Intergenic
1004233295 6:13851803-13851825 CTGTGTCCTCACTTGGTGGAAGG - Intergenic
1004609793 6:17229267-17229289 CTCTGCTGACACTTTGGGCAGGG - Intergenic
1005269863 6:24152273-24152295 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1006214821 6:32431419-32431441 CTGAGTTGTCACTTGGGGGATGG - Intergenic
1007150317 6:39684090-39684112 CTGTGTTCAATCTAGGGGTATGG + Intronic
1008142055 6:47843407-47843429 CTGTGTCCTCACATGGTGCAAGG + Intergenic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1008848219 6:55993835-55993857 CTCTCTTCAGACTTGGGACATGG - Intergenic
1009040612 6:58171830-58171852 CTGTGTTCTCACATGGTGAAAGG - Intergenic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1012706530 6:102538768-102538790 CTGTGTGCAGCCTTGGGACATGG + Intergenic
1013768343 6:113598660-113598682 CTGGGTTCACACCTGGGCCTTGG - Intergenic
1014286501 6:119504628-119504650 CTGTGCTCTCACTTTGGGCCAGG - Intergenic
1014581116 6:123138203-123138225 CTGTGTGCAAACTTGGGACTTGG + Intergenic
1016468893 6:144354127-144354149 CTGTTTTCACACTTGGGTATCGG + Intronic
1018875530 6:167819215-167819237 CTGTGTTCACTCTTTGGGTGAGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1020220624 7:6233924-6233946 CTGTGTCCTCACTTGGTGGAAGG + Intronic
1023515160 7:40994474-40994496 ATCTCTTTACACTTGGGGCATGG - Intergenic
1024907286 7:54400771-54400793 CTATGTTCAGAGATGGGGCATGG - Intergenic
1025886733 7:65601792-65601814 CTGTGTTCTCACATGGTGAATGG + Intergenic
1026136919 7:67671603-67671625 CTCTAGTCACCCTTGGGGCAGGG + Intergenic
1026461849 7:70621294-70621316 CTGTATTCACTGTGGGGGCAGGG + Intronic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1029381194 7:100215918-100215940 CTGGGTTCACACTTGGAACCCGG + Intronic
1030297556 7:107944166-107944188 CTGGATTCATGCTTGGGGCAAGG + Intronic
1033177002 7:139133983-139134005 CTGTGTTCCCACGGGGGACAGGG + Intronic
1034874547 7:154713664-154713686 CTGTGTGCAGACTTGGGACTTGG - Intronic
1035111176 7:156483362-156483384 CGGTGTTCTCAGTTGGGGAATGG + Intergenic
1038006454 8:23434564-23434586 CTGTGGGCAGCCTTGGGGCAGGG + Intronic
1038092105 8:24266437-24266459 CTGTGTTTAGAGTTTGGGCACGG - Intergenic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1039222963 8:35355830-35355852 CTGTTTTCTCACTTGGTGGAAGG - Intronic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1047440363 8:124872233-124872255 CTGTGATCACAGGTGTGGCAAGG - Intergenic
1047712938 8:127570011-127570033 CTGTCTCCACACTTGGAGGAGGG + Intergenic
1047918077 8:129604040-129604062 CTCTGTGCAGCCTTGGGGCATGG - Intergenic
1047958712 8:129995291-129995313 CTTTGTTCACACTTGGCTCTGGG - Intronic
1049218660 8:141418951-141418973 CTTTGCTCTCACCTGGGGCAGGG + Intronic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1051701702 9:19831009-19831031 CTGTGTCCTCACTTGGTGGAAGG + Intergenic
1052622370 9:30930199-30930221 CTGTGTCCCCACTTAGGGGAGGG + Intergenic
1055516451 9:77038443-77038465 CTGTGTATTAACTTGGGGCAAGG + Intergenic
1056105802 9:83345175-83345197 CTGTGTGGGCACTGGGGGCATGG + Intronic
1056589667 9:87956239-87956261 CTGTGTTCACACTTTGGTGGAGG - Intergenic
1057057790 9:91977315-91977337 CTGTGTTCTCACTTAGTGGAAGG - Intergenic
1057177613 9:93011177-93011199 CTGTGTTCAGCCTGGGGCCACGG - Intronic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1059571326 9:115439554-115439576 GTGTATTCAAACCTGGGGCAAGG + Intergenic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1059829154 9:118073138-118073160 CTGTGTTCTCACGTGGGAAAAGG - Intergenic
1060370000 9:123059709-123059731 CTGTGTTCTCATATGGGGCAGGG - Intronic
1060522744 9:124302947-124302969 CTGTGTACCCACTTGGGACGGGG + Intronic
1060559343 9:124530035-124530057 CAGAGTGAACACTTGGGGCAAGG - Intronic
1060860236 9:126948101-126948123 CTGTGTTAACCCTGGGGACAGGG + Intronic
1061421102 9:130473248-130473270 GTGTTTTCCCACTTTGGGCAAGG - Intronic
1061660545 9:132127267-132127289 CTGTGTTCCCACTAGAGGCTGGG - Intergenic
1062290071 9:135790430-135790452 CTGTGTCCACACCTGCGGGATGG - Intronic
1062730124 9:138103999-138104021 CTCTGTCCACACTTGGCGCCGGG + Intronic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1190339311 X:49284293-49284315 CTGTTTCCAGGCTTGGGGCAGGG - Intronic
1192554669 X:72080156-72080178 CTGAGCCCACACTGGGGGCAGGG - Intergenic
1193084122 X:77433455-77433477 CTGTGTTCTCACATGGTGAAGGG + Intergenic
1193392470 X:80945331-80945353 CTGTGTTCTCATTTGGTGTAGGG + Intergenic
1193978408 X:88151650-88151672 CTGTGTTCTCACTTGGAAAAAGG + Intergenic
1195642769 X:107195108-107195130 TTGTGTTGACAATTGGGGCCTGG - Intronic
1196298716 X:114029949-114029971 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1196437603 X:115688991-115689013 CTGCATTCACACCTGGGCCATGG + Intergenic
1196522176 X:116687010-116687032 CTGTGTGCAGCCTTGGGACATGG + Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1198120748 X:133590140-133590162 CTGTGTCCTCACCTGGGGGAAGG - Intronic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1198962497 X:142197018-142197040 GTGCGTGCACACATGGGGCAGGG - Intergenic
1198986522 X:142460660-142460682 CTGTATTCTCACTTGGTGAAAGG + Intergenic
1202099196 Y:21288053-21288075 CTCTGTGCAAACTTGGGACATGG + Intergenic