ID: 945458949

View in Genome Browser
Species Human (GRCh38)
Location 2:210082021-210082043
Sequence GAGCATCACTTGAGCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62836
Summary {0: 1, 1: 11, 2: 674, 3: 10037, 4: 52113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945458949_945458954 3 Left 945458949 2:210082021-210082043 CCTTCTTGGCTCAAGTGATGCTC 0: 1
1: 11
2: 674
3: 10037
4: 52113
Right 945458954 2:210082047-210082069 CCTCAGGCCTCTGAGTAGCTGGG 0: 4
1: 194
2: 7223
3: 117656
4: 220418
945458949_945458957 30 Left 945458949 2:210082021-210082043 CCTTCTTGGCTCAAGTGATGCTC 0: 1
1: 11
2: 674
3: 10037
4: 52113
Right 945458957 2:210082074-210082096 CAGGTGCATGCCACCATGCCTGG 0: 1803
1: 8852
2: 28337
3: 66513
4: 125504
945458949_945458952 2 Left 945458949 2:210082021-210082043 CCTTCTTGGCTCAAGTGATGCTC 0: 1
1: 11
2: 674
3: 10037
4: 52113
Right 945458952 2:210082046-210082068 GCCTCAGGCCTCTGAGTAGCTGG 0: 3
1: 135
2: 5749
3: 102836
4: 208318
945458949_945458956 11 Left 945458949 2:210082021-210082043 CCTTCTTGGCTCAAGTGATGCTC 0: 1
1: 11
2: 674
3: 10037
4: 52113
Right 945458956 2:210082055-210082077 CTCTGAGTAGCTGGGACTACAGG 0: 345
1: 4055
2: 53542
3: 175484
4: 229492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945458949 Original CRISPR GAGCATCACTTGAGCCAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr