ID: 945461643

View in Genome Browser
Species Human (GRCh38)
Location 2:210116332-210116354
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 2, 1: 32, 2: 125, 3: 208, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945461643_945461653 19 Left 945461643 2:210116332-210116354 CCACCCTTAAGGGAAGGACACAA 0: 2
1: 32
2: 125
3: 208
4: 336
Right 945461653 2:210116374-210116396 CTGCTGATGATAGAACTTTTGGG 0: 1
1: 0
2: 0
3: 27
4: 196
945461643_945461654 27 Left 945461643 2:210116332-210116354 CCACCCTTAAGGGAAGGACACAA 0: 2
1: 32
2: 125
3: 208
4: 336
Right 945461654 2:210116382-210116404 GATAGAACTTTTGGGCCTTGAGG 0: 1
1: 0
2: 1
3: 4
4: 118
945461643_945461652 18 Left 945461643 2:210116332-210116354 CCACCCTTAAGGGAAGGACACAA 0: 2
1: 32
2: 125
3: 208
4: 336
Right 945461652 2:210116373-210116395 CCTGCTGATGATAGAACTTTTGG 0: 1
1: 0
2: 1
3: 34
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945461643 Original CRISPR TTGTGTCCTTCCCTTAAGGG TGG (reversed) Intronic
902318916 1:15645941-15645963 TTGTGGCCTTCACTGTAGGGTGG + Intronic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
906870708 1:49477145-49477167 TTATATCCTTCCCTTCAGTGAGG - Intronic
907261676 1:53222828-53222850 TTGTGTCTTACCCTTTGGGGTGG - Intergenic
908951209 1:69565732-69565754 TTGTGCCCTTCCTGTAAGTGTGG + Intergenic
908958826 1:69670576-69670598 TTGTGTCTCTCCCTTCATGGTGG + Intronic
909209637 1:72807536-72807558 TTGTGTTCTTACGTTCAGGGTGG + Intergenic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
909978889 1:82074613-82074635 TTGTGTGATTCCCTTGAGTGGGG - Intergenic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
910515303 1:88053993-88054015 TTGTGTCCATCCCTTCAGGGTGG + Intergenic
911239306 1:95448467-95448489 TTGTGTGCTTCCCTTCAGGGTGG + Intergenic
911296505 1:96123842-96123864 TTTTGTCCTTGGCTTATGGGAGG + Intergenic
911536497 1:99106363-99106385 CTGTGTCCCTCCTTTCAGGGTGG - Intergenic
911975584 1:104489949-104489971 TTGTGTTCTTCCCTTTAGGGTGG - Intergenic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912127400 1:106555743-106555765 CTGTTTCCTTCCCTTCAGGATGG - Intergenic
912633186 1:111267097-111267119 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
913512513 1:119574411-119574433 CTGTGTCCTTCCCTCAGAGGTGG - Intergenic
913706998 1:121434936-121434958 TCGTGTCCTTCCCTTCAGGGTGG - Intergenic
915856916 1:159397829-159397851 CTGTGTCCTTTGCTTTAGGGTGG - Intergenic
916360646 1:163963350-163963372 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
917003279 1:170385009-170385031 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
917373005 1:174316720-174316742 CTGTGTCCTTCCCTTTAGGGTGG + Intronic
917794199 1:178521120-178521142 TTCTGTCCTTCCCTTTAGCAAGG + Intronic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
918358087 1:183724745-183724767 TCATGTCCTTCGCTTAAGGATGG - Intronic
919003209 1:191860911-191860933 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
919067843 1:192715113-192715135 TCATGTCCTTCCCTTCAGGGTGG - Intergenic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
920666923 1:207969769-207969791 TTGTGCCCATCCCTGAAGAGGGG + Intergenic
921296075 1:213705187-213705209 CTGTGTCCTTTCCTTCAAGGTGG + Intergenic
921351561 1:214241510-214241532 TTGTGTTCCTCCATTCAGGGAGG + Intergenic
921929285 1:220742085-220742107 TTACATCCTTCCCTTCAGGGTGG + Intergenic
922320409 1:224481820-224481842 TTGTATACTCCCCTTAAGAGCGG + Intronic
923886535 1:238164135-238164157 CTGTGTCCTTCTTTTTAGGGTGG + Intergenic
924516104 1:244767784-244767806 TTGTGCTCTTCCCTTCAGAGCGG + Intergenic
1064693600 10:17943207-17943229 GTGTCTCCTCCCCTTAAGTGTGG + Intergenic
1064987428 10:21225453-21225475 TTATGTTCTTCTCTTGAGGGTGG + Intergenic
1066649637 10:37642426-37642448 TTATGTCCTTCCCTTCAAGGTGG + Intergenic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1067084780 10:43231968-43231990 TTGTGCCCTGCCCCTAAAGGAGG - Intronic
1068217352 10:53999777-53999799 CTGTGTCTTTCCCTTCAGGGTGG - Intronic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1068478695 10:57562381-57562403 CTGTGTCCTTCCCTTCAGGATGG + Intergenic
1069248884 10:66244323-66244345 TTATGTCCTTCCCTTCCGGGTGG - Intronic
1069343572 10:67440418-67440440 TTATGTCCTTCCCTTCAGAGTGG - Intronic
1071046618 10:81387140-81387162 TTGTGTCCCTCCCTTTAGTGTGG + Intergenic
1071119420 10:82260756-82260778 TTGTGTCCTGCCTGTATGGGGGG - Intronic
1071767899 10:88689557-88689579 TTGTGTCCTTCCTTTCAAGGTGG - Intergenic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1072399835 10:95086716-95086738 TTGTGTCCTTCCCTCCAGGATGG + Intergenic
1072877765 10:99191205-99191227 TTGTTTCCTTGCATTCAGGGTGG - Intronic
1073678910 10:105680389-105680411 CTGTGTCCTTTCCTTCAGGGTGG - Intergenic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1074097094 10:110323528-110323550 CTGTGGCCTTCCCTTCAGAGTGG - Intergenic
1075195017 10:120348721-120348743 TTATGTCCTTCCCTTCAGAATGG - Intergenic
1076094702 10:127721441-127721463 CTGTCTCCTTCCCTTTAGGAAGG - Intergenic
1077427513 11:2490353-2490375 TTTTGTCCTTCACTTTAGGGTGG - Intronic
1077740497 11:4840253-4840275 CTGTGTCCTTTCCTTCAGGAAGG - Intronic
1077970348 11:7182308-7182330 TTGCGTCCTTCCCTTCAGGATGG - Intergenic
1078842995 11:15096489-15096511 TTGTGTCCTTTCATTCATGGTGG + Intergenic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1079961335 11:26927860-26927882 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1080128661 11:28767168-28767190 TTGTGTCCTTCCCTTCAGTGTGG - Intergenic
1082122670 11:48396268-48396290 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082251965 11:49992404-49992426 CTGTGTCCTTCTTTTCAGGGTGG - Intergenic
1082556374 11:54567544-54567566 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082823716 11:57562404-57562426 TTGTGTTCTTCCCCTTAGGGTGG - Intronic
1083512695 11:63226711-63226733 TTGTGTCCTTCCTTTCAGGGTGG + Intronic
1083823842 11:65187311-65187333 GTGGGGCCTTCCCTGAAGGGCGG + Intronic
1083825564 11:65201480-65201502 TTTTTTCCTTCCCTCCAGGGAGG + Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1085572038 11:77568375-77568397 TTGTGTCCTTCCTTTTAGGGTGG + Intronic
1085981573 11:81732697-81732719 CTGTGTTCTTCCCTTCAGGATGG + Intergenic
1086027754 11:82315003-82315025 CTGTGGCCTTCCATTATGGGTGG - Intergenic
1086068839 11:82776434-82776456 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1086071601 11:82805706-82805728 ATGTGTCCTCCCCGTGAGGGAGG - Intergenic
1087031937 11:93715064-93715086 TTATGTCCTTGCCTTCAGGGTGG + Intronic
1087147413 11:94825864-94825886 TTGTGTCATTCTCTGAAAGGAGG + Intronic
1087472898 11:98600419-98600441 TCGTGTCCTTTCCTTCAGGATGG + Intergenic
1087598310 11:100282652-100282674 CAGTGTCCTTCCTTTCAGGGTGG + Intronic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1087877022 11:103370399-103370421 CTGTGTCCTTCCCTTCAGGTTGG - Intronic
1087950738 11:104218309-104218331 TTATGTTCTTCCCTTCAGGGTGG + Intergenic
1088009894 11:104986897-104986919 TTGTGTTCTTCCATTCAAGGTGG - Intergenic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088210852 11:107454085-107454107 CTGCGTCTTTCCCTTCAGGGTGG - Intronic
1088411436 11:109539148-109539170 TTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1088570014 11:111213657-111213679 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1089824623 11:121264255-121264277 CTATATCCTTCCCTTTAGGGTGG + Intergenic
1090318212 11:125816785-125816807 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
1091412657 12:254276-254298 TTGTGTATTTCCCTTCTGGGCGG - Intronic
1091987453 12:4923552-4923574 TGGTGTCCTTTCCTTTGGGGAGG + Intronic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1093123947 12:15306522-15306544 CTGTGTCCTTCCCTTCAGTGTGG + Intronic
1093259428 12:16917448-16917470 TTTTGTCCTTCCATTCAGGGTGG + Intergenic
1093356819 12:18176883-18176905 TTGTCTCCTTCCCACTAGGGTGG + Intronic
1093419952 12:18964176-18964198 TTGTGTTCTTCCCTTCAGGATGG + Intergenic
1093617291 12:21241594-21241616 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1093903217 12:24660670-24660692 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1094655815 12:32418780-32418802 TTGTGCCCTTCCCTCCAGGGTGG + Intronic
1094658116 12:32440738-32440760 CTGTGCCATTCCCTTCAGGGCGG + Intronic
1095133726 12:38572522-38572544 CTGTGTCCTTCCCTTTAGTGTGG - Intergenic
1095163407 12:38942263-38942285 TTGTATCTTTCCCTTCAGGGTGG - Intergenic
1095169777 12:39020302-39020324 TTATGTTCTTCCCTTCAGGGTGG - Intergenic
1097150816 12:56978685-56978707 CTGTGCCCTTCCCTTCAGGATGG + Intergenic
1097425966 12:59445477-59445499 TTGTGTCCTTCCATTCAGGGTGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1097770012 12:63572503-63572525 TGGTGACCTTCCCTTCAGGGTGG - Intronic
1098142831 12:67468792-67468814 TTGTGTCCTTCCCTTTAGAGTGG + Intergenic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098491952 12:71092588-71092610 CTGTGTCCTCCACTTCAGGGTGG + Intronic
1098667258 12:73179956-73179978 TTGTGTCCTTCCTTTCATGGTGG + Intergenic
1099564838 12:84230220-84230242 CTGTGTTCTTCCCTTTAGGATGG + Intergenic
1099764081 12:86960392-86960414 TCGTATCCTTCCCTTTGGGGTGG + Intergenic
1099888952 12:88566022-88566044 TTGTGTCATTTCCTTAAGAATGG + Intronic
1100360716 12:93877397-93877419 CTGTGACCTTCCCTTCAGGGTGG + Intronic
1100904991 12:99286978-99287000 TTATGCCCTTCCCTTCAGGGTGG - Intronic
1100909098 12:99338095-99338117 TTGTGTACTTCCCTTCAGGGAGG + Intronic
1100923883 12:99521949-99521971 CTGTGTCCTTCCCTTTAGGGCGG + Intronic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102182696 12:110924129-110924151 TTGTGCCCTGCCCTCAAGGCTGG + Intergenic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1104103066 12:125633995-125634017 TGGTGCCCTTCCCTTCAGGGTGG + Intronic
1104575350 12:129961701-129961723 TGGTGTCCTGCCCTTAAGCAAGG - Intergenic
1105273510 13:18900272-18900294 TTGGGTCCATCCCATCAGGGTGG - Intergenic
1105336309 13:19473275-19473297 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1105790507 13:23793710-23793732 TGGGGTCCTTCCCTTAAGATGGG - Intronic
1106011147 13:25824626-25824648 TTGTTTCTTTCCCTTAGGAGAGG + Intronic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106349903 13:28920623-28920645 TTGTGTCCCTTTCTTCAGGGTGG + Intronic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1107524127 13:41213603-41213625 TTGTGTCCGTCTCTTCAGGATGG + Intergenic
1107774329 13:43822506-43822528 TTGTGTCCCTTCTTTAAGGGTGG + Intergenic
1107785452 13:43952204-43952226 TTGTGTCCTTACCTGATGGAAGG + Intergenic
1108138081 13:47386570-47386592 TTGTGTCCTTCATTTCAGGATGG - Intergenic
1108183831 13:47868798-47868820 TTGAGTCATTCCCTTAAGACTGG + Intergenic
1108631607 13:52289180-52289202 CTGTGTCCTTCCCTTCACGATGG + Intergenic
1108655088 13:52523415-52523437 CTGTGTCCTTCCCTTCACGATGG - Intergenic
1108922617 13:55694051-55694073 CTGTGTCCTTCCCTTCATGGTGG - Intergenic
1108973319 13:56403419-56403441 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1109100632 13:58180436-58180458 TTCTCTCCTTCCCTTCAGGGTGG + Intergenic
1109336612 13:61003063-61003085 TTGTGTTCTTTCCTTCAGGTTGG + Intergenic
1109567149 13:64132053-64132075 TTATTTCCTTCCCTTCATGGGGG - Intergenic
1109961564 13:69638777-69638799 TTGTATCTTTCCCTTGAGTGTGG + Intergenic
1110376805 13:74803152-74803174 TTGTGTCCTTTCCTTTAGGTTGG - Intergenic
1111085747 13:83373441-83373463 TCCTGTCTTTCCCTTAATGGTGG + Intergenic
1112493159 13:99884959-99884981 TTGTGTCCTTCTATTCAGGTAGG + Intronic
1112940534 13:104855668-104855690 TTGTGTCCTTCACTTTAGGGTGG - Intergenic
1113030613 13:105990096-105990118 TTGTCTCCTTCCCTCAGAGGTGG + Intergenic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1115821078 14:37212645-37212667 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1115948733 14:38695125-38695147 TTATGTCCTTCCCTTTATGTTGG - Intergenic
1116021553 14:39468449-39468471 TTGTGTCCTTTCCTTCAGGGCGG + Intergenic
1116057955 14:39886450-39886472 CTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1116106520 14:40514478-40514500 TTACGTCCTTCCCTTCAGGCTGG - Intergenic
1116192668 14:41680192-41680214 TTGTGTTCTTCCATTCAGGGTGG - Intronic
1116430123 14:44836266-44836288 TTATGCCCTTCCCAGAAGGGGGG + Intergenic
1116481159 14:45392575-45392597 TTGTGTTCTTCCCTTCAGGATGG - Intergenic
1116504763 14:45664970-45664992 CTGTGTGCTTCCTTTCAGGGTGG + Intergenic
1116669364 14:47821470-47821492 TTGTGTCTTTCCCTTCAGGTTGG + Intergenic
1116766033 14:49071140-49071162 TTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1117110432 14:52447343-52447365 CTGTGTTCTTCCCTTTAGGATGG - Intronic
1117159296 14:52973229-52973251 CTGTGTCCTTCCCTTTATGGTGG + Intergenic
1117809577 14:59532578-59532600 TTCTGGCCTTCCCTTGTGGGTGG + Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1119679994 14:76585075-76585097 TTGTGGGCTTCCCTTAAGAGTGG - Intergenic
1120107650 14:80515261-80515283 TTGTGGCCTTTCCTTCAGAGTGG + Intronic
1120394937 14:83956787-83956809 GTTTGTCCTTCCCTTGAGGTAGG - Intergenic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1121088506 14:91164908-91164930 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121088666 14:91166312-91166334 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121230478 14:92354011-92354033 TTGTGTCCCTCCCATGAGGGTGG + Intronic
1121759684 14:96434659-96434681 CTGTTTCCTTCCCTTCAGGGTGG + Intronic
1124081305 15:26500871-26500893 CTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1125044409 15:35230087-35230109 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1125910139 15:43430125-43430147 TTGTTTCCTTCCCTTAATGGTGG - Intronic
1126015749 15:44348588-44348610 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1126053235 15:44706821-44706843 TTATGTCCCTCTCTTTAGGGTGG + Intronic
1126216335 15:46158440-46158462 TTGTGTCCTACCCTTCAGGAAGG - Intergenic
1126440627 15:48684057-48684079 TTGTGCATTTCCCTTTAGGGTGG - Intergenic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1127140359 15:55969674-55969696 CTGGGTCCTTTCCTTCAGGGTGG - Intronic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1129642483 15:77394205-77394227 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1130441072 15:83955084-83955106 TTATGTTCTTCCCTTCAGGGAGG + Intronic
1130961792 15:88664247-88664269 TTGCGTCCTTTCCTTCAGGATGG - Intergenic
1131323438 15:91420356-91420378 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1131944990 15:97609634-97609656 TTGTGTTCTTCCTTTCATGGTGG - Intergenic
1132230551 15:100180883-100180905 GCTTGTCCTTCCCTTCAGGGCGG + Intronic
1133834082 16:9351101-9351123 CTGTGTCCTTTCTTTTAGGGAGG + Intergenic
1137293135 16:47065873-47065895 CTAAGCCCTTCCCTTAAGGGTGG - Intergenic
1140276500 16:73513549-73513571 TTGTGGGCTGCCCTTGAGGGAGG - Intergenic
1142164788 16:88580464-88580486 CTGGGTCCTTCCCACAAGGGTGG - Intronic
1142966233 17:3583532-3583554 GTGTGTCCTTCCCCTGATGGAGG - Intronic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1147596143 17:41718782-41718804 ATGTGTCCTTCCGTTGAGTGAGG + Intronic
1149111232 17:53033297-53033319 TTATGTCTTTCCCTTTAGGATGG + Intergenic
1149157284 17:53647321-53647343 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149239858 17:54636135-54636157 TGGTGTCCTTCCCTTCAAGGTGG - Intergenic
1149906322 17:60529377-60529399 GTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1150550446 17:66204684-66204706 TTGTGTCCCTCCCTTCAGGGTGG - Intergenic
1150871107 17:68911513-68911535 CTGTGTCCTTCCCTTTATGGTGG - Intronic
1153028621 18:692798-692820 CTGTGTCCTTCCCCTACGGATGG + Intronic
1153183192 18:2459156-2459178 TTATATCCTTCCCTTCAGGGTGG + Intergenic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155597373 18:27503069-27503091 TTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1156072083 18:33224185-33224207 TCTTGTCCTTCCCTGCAGGGAGG - Intronic
1156094329 18:33510834-33510856 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1156912307 18:42425575-42425597 TTGTGTGCTTCCCTTTAGGATGG + Intergenic
1157744095 18:50119655-50119677 ATGTCTCCTTCTCCTAAGGGAGG + Intronic
1157804456 18:50647862-50647884 AGGTGCCCTTCCCTGAAGGGTGG - Intronic
1158481194 18:57823459-57823481 TTGTATCATTCCCTTCGGGGTGG + Intergenic
1158723244 18:59944781-59944803 TTGTGTACTTTCTTTAATGGCGG + Intergenic
1158742670 18:60161727-60161749 TTATGTAATTCCCTTGAGGGAGG + Intergenic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159260284 18:66004808-66004830 TTGTGTTCTTCTCTTCAGGGCGG - Intergenic
1159802501 18:72919160-72919182 TTGTGTTCTACCCTTCAGTGTGG + Intergenic
1162666799 19:12220410-12220432 CTGGGTCCTTCCCTTCAAGGCGG + Intergenic
1162692940 19:12449028-12449050 TTGTTTCCTTCCCTTCAGGGTGG + Intronic
1166150723 19:40873261-40873283 TTTTGTTCTTCCCTTTGGGGTGG - Intronic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
1167929726 19:52854392-52854414 TTGTGTCATTGTGTTAAGGGAGG - Intronic
1168605784 19:57759039-57759061 TTATGTCCTTCCCTTCAGAGTGG - Intergenic
925034217 2:673662-673684 TTGAGTCCATTCCTGAAGGGAGG - Intronic
925698866 2:6613128-6613150 TTATGTCCTTCCCTTCAGGATGG + Intergenic
925793051 2:7512477-7512499 TGGTGTACTTCCCTTACAGGTGG + Intergenic
926549522 2:14284767-14284789 TACTGTCCTTCCTTTGAGGGAGG - Intergenic
926602115 2:14855847-14855869 CTGTGTTCTTTCCTTTAGGGTGG - Intergenic
927309710 2:21616989-21617011 CTGTGTCCTTCACTTCAGGGTGG + Intergenic
927594652 2:24385980-24386002 CTGTGTCCTTCCCTTCAGGACGG + Intergenic
928472302 2:31586332-31586354 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
928768002 2:34670937-34670959 AAGTGTCTTTCCCTTCAGGGAGG - Intergenic
928783659 2:34854982-34855004 CTATGTCCTTCCCTTCATGGTGG - Intergenic
928802984 2:35116257-35116279 CTGTGTCCTTTTCTTTAGGGTGG - Intergenic
928862390 2:35874701-35874723 CTATATCCTTCCCTTCAGGGTGG + Intergenic
928996548 2:37297965-37297987 TTGTTTCCTTTCCTTGAAGGTGG + Intronic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
929735566 2:44545191-44545213 TTGTGTCCTGCTCTTAGGAGAGG + Intronic
930159300 2:48137955-48137977 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
930288777 2:49467560-49467582 TTGTGTCCTTCGCTTCAGGGTGG + Intergenic
930345223 2:50171797-50171819 TTGTTTCCTTTCCTTCAGGCGGG - Intronic
930727485 2:54695808-54695830 TTATGTACTTCCCTTTGGGGTGG - Intergenic
930981178 2:57528216-57528238 CTGAGTCCTTCCCTTCAGAGAGG + Intergenic
931572346 2:63681612-63681634 CTGTGTCCTTCCCTTCAAGGTGG - Intronic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
931989882 2:67779359-67779381 CTGTGAACTTCCCTTCAGGGTGG - Intergenic
932648720 2:73532310-73532332 TTGTGTGCTTTCCTTCAGGGTGG + Intronic
933077825 2:77951697-77951719 TTGTGTACTTCACTTAAGGGTGG - Intergenic
933162938 2:79045600-79045622 CTGTGTCCTTCACTTCAGGATGG - Intergenic
933333242 2:80921429-80921451 TTGTGTCCTTCCCCCAAGGCAGG + Intergenic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
935576498 2:104716977-104716999 TTGTGTCTTTCCCTTCAGGCTGG + Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
936925424 2:117731519-117731541 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
937628409 2:124069418-124069440 TTGTGCCTTTCCATTCAGGGTGG - Intronic
937986508 2:127640488-127640510 TGTTGTCCTTCCCGGAAGGGTGG - Intronic
938475491 2:131607560-131607582 TTGTGTTCTTCCTTTAAAGAAGG + Intergenic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
938587877 2:132708633-132708655 TTGTGTCCTTTCCCTCAGGATGG - Intronic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
940100738 2:150035548-150035570 GTGTGAACTTCCCCTAAGGGAGG + Intergenic
940468745 2:154065305-154065327 TTGTGTCCTTCCCTCCAGGATGG - Intronic
940559742 2:155280740-155280762 TTTTCTCTTTCCCTTTAGGGTGG + Intergenic
941678688 2:168371673-168371695 TTGAGTCTCTCTCTTAAGGGTGG - Intergenic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
942391708 2:175502187-175502209 TTGTGTTCTTCCCTTCAGGTTGG + Intergenic
942750152 2:179277538-179277560 CTGTGTTCCTCCCTTCAGGGTGG - Intergenic
942769168 2:179495433-179495455 CTGTTTTCTTCCCTTTAGGGCGG - Intronic
943170153 2:184387126-184387148 TTGTGTCCTTCCCTACAGGTTGG - Intergenic
943237163 2:185337597-185337619 ATGTGTCCTTCCCTTCATGGTGG + Intergenic
943427810 2:187758740-187758762 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
943866964 2:192937850-192937872 TTGGGTCTTTCCCTTCAGGGTGG + Intergenic
943967399 2:194354309-194354331 TTGATTCCTTCCCTTCAGGGTGG - Intergenic
944046253 2:195414663-195414685 TTGTATCCTTCTGTTAAGGGTGG - Intergenic
944751911 2:202717869-202717891 TTGTGTCCTTTCCTTCCTGGTGG + Intronic
944760459 2:202808532-202808554 TTGTGTCGTTCTCTTCAGGGTGG - Intronic
944854995 2:203759270-203759292 TTGTGTCTTTTTCTTCAGGGAGG + Intergenic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
945551821 2:211229658-211229680 TTGTGTTCTTCCTTTTAGGATGG - Intergenic
945739682 2:213644923-213644945 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
946052437 2:216875028-216875050 TTTTGTGATTCCCTGAAGGGCGG + Intergenic
948774752 2:240278294-240278316 TTGTGTCCTTCCCTTATGGGTGG - Intergenic
1169617886 20:7470897-7470919 CTGTGTCCTTCACTTCAAGGCGG + Intergenic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1170311555 20:14997678-14997700 TTCTGTCTTTCCCTTCAGGGTGG - Intronic
1173167818 20:40698438-40698460 TTGTGTCCTGCCCTCAAATGTGG - Intergenic
1174831772 20:53820176-53820198 TTTTATCCTTCCCTTCAGTGTGG + Intergenic
1175023865 20:55880789-55880811 TTGTGGCTTTCCCTTCAGAGCGG + Intergenic
1176737241 21:10561812-10561834 CTGTGTCCTTGCCTTCAGGATGG - Intronic
1176899410 21:14420889-14420911 CTGTGTTCTTCCCTTCAGTGTGG - Intergenic
1177105266 21:16946724-16946746 TTGTGGGCTTCCCTTCAAGGTGG - Intergenic
1177401127 21:20606281-20606303 TTGTGTCATTCCCTTCAGGATGG - Intergenic
1177592301 21:23185925-23185947 TTTTTTCCTTCCCTTCAGGGTGG - Intergenic
1177771394 21:25519788-25519810 TTGTGTTCTTCCCTTTAGGGTGG - Intergenic
1178007317 21:28235584-28235606 TTATGTTCTTCCCTTCAGGGCGG - Intergenic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1180563245 22:16639363-16639385 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1180723135 22:17924205-17924227 TGGTGGCCTTCCCATAAGGATGG - Intronic
1181236682 22:21451202-21451224 TTATGCCCTTCCCAGAAGGGGGG + Exonic
1183531883 22:38360781-38360803 CTGTGTCCTTCCCTTCAGGATGG + Intronic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
951032153 3:17894975-17894997 CTGTGTCCTTCCTTTCATGGTGG + Intronic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951279466 3:20731112-20731134 TTGTGTTCTTCCCTTCAGGGTGG + Intergenic
951436898 3:22675969-22675991 TTGTGTACTTCTCTTCAGGGTGG + Intergenic
951794470 3:26523462-26523484 CTGTGTCTTTCCCTTTAGGGTGG + Intergenic
951819279 3:26790704-26790726 CTGTTTCCTTCCCTTCAGGATGG + Intergenic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
952066365 3:29576549-29576571 TTGTGTCCCTACCTTCAGGATGG + Intronic
952117020 3:30195077-30195099 TGGTTTCTTTCCCTTCAGGGAGG - Intergenic
952139750 3:30465685-30465707 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
952639855 3:35580154-35580176 CTGTGTCCTTACCTTCATGGTGG - Intergenic
953211959 3:40884112-40884134 GTGTGTCCTCCCTTTAAGAGTGG - Intergenic
953217298 3:40931235-40931257 TTGCATCCCTCCCTTCAGGGTGG - Intergenic
953229299 3:41050422-41050444 CTGTGTCTTTTCCTTTAGGGTGG + Intergenic
953309437 3:41863020-41863042 GCCTGTCCTTCCCTTCAGGGCGG + Intronic
953352409 3:42225302-42225324 ATGTGTCCTTCCATTGAGTGAGG + Exonic
954880325 3:53831337-53831359 TTGTGGCCTTCCCTTTGGGGCGG - Intronic
955201369 3:56854869-56854891 TTGTGTCCATCCCTTAATTGGGG - Intronic
958669057 3:97179960-97179982 CTGTTTCCTTGCCTTAAGGTTGG + Intronic
958839586 3:99187154-99187176 TGGTGTCCTTCCATTGAGGGTGG - Intergenic
958876766 3:99625267-99625289 CTTTGTCCTTCACTTCAGGGTGG - Intergenic
959042003 3:101432367-101432389 CTGTGTTCTTCCCTTCAGGATGG - Intronic
959113532 3:102149371-102149393 TTGTGTCCTTCCATTCAGGGTGG - Intronic
959328668 3:104973222-104973244 CTGTGTCTTTGCCTTCAGGGTGG + Intergenic
959408983 3:105997326-105997348 TTGTTTTCTTCCCTTTAGGGTGG + Intergenic
959547360 3:107612812-107612834 TTGTGTCCTTCTGTTCAGGGTGG + Intronic
959806530 3:110561645-110561667 TTGTATCTTTCCCTTCAGAGTGG + Intergenic
959841722 3:110984132-110984154 TTGTGTCCTTCTCTTCAGCGTGG - Intergenic
959868457 3:111299628-111299650 TTTCGTCCTTCCCTTCAGAGTGG + Intronic
959891939 3:111566779-111566801 TTGTGTCATTCCTTTGTGGGAGG + Intronic
960404231 3:117239275-117239297 CTGTGTCCTTCTCTTCAGGTTGG - Intergenic
960471771 3:118075146-118075168 CTGTTTCCCTCCCTTCAGGGTGG + Intergenic
960692642 3:120363024-120363046 TTCTGTCAGTCCCTTAAAGGTGG + Intergenic
961690825 3:128668344-128668366 GTTTGTCCTTCCCTTGAGGCAGG - Intronic
962015234 3:131432171-131432193 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
962698931 3:137978505-137978527 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
963310168 3:143700743-143700765 TTGTATCCTTCCCTTCAAGGTGG - Intronic
963361762 3:144282647-144282669 TTCTGCCCCTCCCTTAAAGGGGG - Intergenic
963365119 3:144324162-144324184 CTGTGTCTTTCCCTTTAGGGTGG - Intergenic
964179483 3:153865900-153865922 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
964398356 3:156272272-156272294 TTTTGTCCTTCCTTTCAGGGTGG + Intronic
964964985 3:162481489-162481511 TTGTTTCTTTCTTTTAAGGGTGG + Intergenic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
965526981 3:169731170-169731192 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
965742414 3:171889938-171889960 CTGGGTCCTTCCCTTCAAGGCGG + Intronic
965844598 3:172946770-172946792 TTGCGTCCTTCCCTTCAGGGTGG - Intronic
966151188 3:176869092-176869114 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
968018109 3:195357400-195357422 TTGTGTATTTCCCTTCGGGGTGG - Intronic
968096228 3:195932673-195932695 TTGTGTCTTTCTTTTCAGGGCGG - Intergenic
968334571 3:197901806-197901828 TTGTATCCTTCCCTTCAGAGTGG - Intronic
970915462 4:21328649-21328671 TTATTTCCTTCCCTTCAGGGCGG + Intronic
971612100 4:28738658-28738680 TTGTGGACTTCACTTAAGGGAGG - Intergenic
971891540 4:32529816-32529838 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
972104078 4:35461190-35461212 CTATGTCCTTCCCTTCAAGGCGG + Intergenic
972321319 4:37975992-37976014 TTATCTCCTCCCCTTAAGTGTGG + Intronic
972579336 4:40380723-40380745 TTGTGTTCTTCCCTTCAAGGTGG - Intergenic
972851691 4:43057832-43057854 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
972902669 4:43703694-43703716 TTATTCCCTTCCCTTCAGGGTGG + Intergenic
973327358 4:48877387-48877409 GTGTATCCTTCCCTTCAGAGTGG + Intergenic
973919723 4:55673077-55673099 TTGTGTCCTTCCCTTCAGAGAGG + Intergenic
974231196 4:59116468-59116490 TTGTCTCCTTTCCTGAAGGATGG + Intergenic
974267024 4:59598637-59598659 TTTTGTCCTTCCCTTCAAGGTGG - Intergenic
974867861 4:67602950-67602972 TTGTGTCCTTCCCTTCAGATTGG + Intronic
975313059 4:72925082-72925104 TAGTGTCCTTCCCTTCAGGATGG + Intergenic
976016501 4:80560891-80560913 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977184964 4:93925469-93925491 TTCTGTCCTTCCCTTCAATGTGG - Intergenic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
978082859 4:104616097-104616119 TTTTGTCCTGCCCTTCAGGGTGG + Intergenic
978112497 4:104979134-104979156 TTGAGCCCTTCCGTTCAGGGTGG - Intergenic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979184703 4:117773271-117773293 TTGTGTCCCTCCCTTCAAGTTGG - Intergenic
979213205 4:118132131-118132153 TTGTGTCCTTCCCTTCAGAGCGG + Intronic
979573071 4:122252729-122252751 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
980442582 4:132867810-132867832 TAGTGTCCCTCCCTTCAGGGTGG - Intergenic
980597005 4:134967185-134967207 TTGTGTCTTTCTTTTCAGGGAGG - Intergenic
980712818 4:136591920-136591942 TTGTGTCCTTCCCTTTGGATTGG - Intergenic
980771258 4:137376724-137376746 TTTTTTCCTTACCTAAAGGGGGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
981394773 4:144234461-144234483 TTGTGTTTTTCCCTTGAGGGTGG - Intergenic
981518270 4:145634128-145634150 TTATGTCCTTCATTTGAGGGTGG + Intronic
981747657 4:148067040-148067062 TTCTGTCCCTCCCCTAAGGCTGG + Intronic
982042652 4:151410295-151410317 TTGGCTCTTTCCCTTCAGGGGGG - Intronic
982622851 4:157728307-157728329 TTGTGTCCTATCTTTCAGGGTGG - Intergenic
982719826 4:158848065-158848087 TTGTGTCCTTCCCTCAAAGGTGG - Intronic
983017307 4:162628922-162628944 TTTTGTCCTTCCCTTTAGGGTGG - Intergenic
984658709 4:182349554-182349576 ATGTGTCTTTCCCTTAAGCTGGG + Intronic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
987631540 5:20478681-20478703 TTGTGTCCTACCCTTCAGGGTGG - Intronic
987645946 5:20672464-20672486 TTGTGCCTTTCCCTTCTGGGTGG - Intergenic
988001814 5:25358973-25358995 TTGTTTCCTTTCCTTCAGGGTGG - Intergenic
988039775 5:25874357-25874379 TAGTGTCCTTCCTTTCAGGGTGG + Intergenic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
988384284 5:30540375-30540397 TTGTGTCCCTCCCTTTAGGATGG - Intergenic
988939424 5:36127830-36127852 TTTTGTTCTTCCCTTCAGAGTGG - Intronic
988990760 5:36668508-36668530 GTAGGTCCTTCCCTTAAAGGAGG - Intronic
989671642 5:43924554-43924576 TTATGTCCTTCCCTTCAGGATGG + Intergenic
989672681 5:43936746-43936768 GTGTGTCCTTTGCTTCAGGGTGG - Intergenic
989681319 5:44032621-44032643 CTGTGTCCTTCCCTTCTGGGTGG - Intergenic
989970669 5:50520962-50520984 TCGTGTCCTTCCCTTCAGGGTGG + Intergenic
990578900 5:57149974-57149996 TTGTGTTTTTCCCTTCAGGGTGG + Intergenic
990830018 5:59945853-59945875 TTGAGTCATTCCTTTAAGTGAGG - Intronic
990923726 5:60995751-60995773 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
992309641 5:75482450-75482472 CTATGTCCTTCCCTTTAGGGTGG - Intronic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
992587245 5:78252806-78252828 CTGTGTCCTTCCCTTAAGGGTGG - Intronic
993155674 5:84218931-84218953 TTGTGTCGTTTGCTTCAGGGTGG - Intronic
993175823 5:84483811-84483833 TTGTCTTATTCCCTTAATGGTGG - Intergenic
993623392 5:90193577-90193599 GTGTGTCATTCCCTTCAGGGAGG - Intergenic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
994274627 5:97821614-97821636 CTGGGCCCTTCCCTTCAGGGTGG + Intergenic
994292980 5:98051443-98051465 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
994627850 5:102243274-102243296 TTGTGTCCTTCGCTTGGGTGGGG - Intronic
994660084 5:102642434-102642456 TTGTGTCTATCTCTTTAGGGTGG - Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
995019521 5:107351613-107351635 TTGTGTCTTTCCCTTAGGGGTGG + Intergenic
995034686 5:107519982-107520004 TTGTTTCCTTTCTTTAAAGGGGG + Intronic
995096444 5:108240635-108240657 TTGTATCCTTCCCTTCAGGGTGG - Intronic
995146832 5:108796442-108796464 TTGTGTCCTTTCCTCAAGGGTGG + Intronic
995697720 5:114899152-114899174 TTGTCTCCTTCCCTTCAGGGTGG + Intergenic
995770686 5:115665795-115665817 TTATGTCCTTCCCTTCAGTGGGG - Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996129107 5:119759611-119759633 ATGTGAGCTTCCCTTAAGGGAGG + Intergenic
996161702 5:120174268-120174290 CTATGTCCTTCCCTTCATGGAGG - Intergenic
996190887 5:120540211-120540233 TTGTGTCCTGGCCTGAAGGGAGG - Intronic
996773364 5:127108687-127108709 CTGTGCCCTTCCCTCAAAGGTGG + Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
997186328 5:131885107-131885129 TTATGTCCTTCCCTGCAGGGTGG - Intronic
997602121 5:135147768-135147790 TTGTGTAATTCCCTTGAGTGTGG + Intronic
997832740 5:137164995-137165017 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
999678462 5:154031397-154031419 TTGTTTTCTTCCTTTAAAGGGGG - Intronic
1001014645 5:168129042-168129064 TGGTGTCCTTTTCTTAATGGGGG - Intronic
1003952242 6:11127203-11127225 TTCTGTCCTTCCCATTAGGGTGG + Intronic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1008171608 6:48214402-48214424 ATGTGTCCTCCCCATGAGGGAGG + Intergenic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1008940600 6:57041419-57041441 TTGTTTCCTTCCCTTCAGGGTGG - Intergenic
1009301700 6:62031810-62031832 CTGTGTCCTTCCCTTCTGGGTGG - Intronic
1009353342 6:62709009-62709031 TTGTGTCTTTCCCTTAAGTGTGG + Intergenic
1009373452 6:62938149-62938171 TTCTGTCTTTCCCTTCAGGATGG + Intergenic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010343296 6:74782013-74782035 TTGTATACTTCCCTTCAGGGTGG - Intergenic
1010483496 6:76382149-76382171 CTATGTCCTTCCCTTCAGAGTGG + Intergenic
1011019037 6:82789832-82789854 TTGTGTTCTTCCCTTCATGGAGG - Intergenic
1011024005 6:82846042-82846064 TTATGTCCTTGCTTTCAGGGTGG - Intergenic
1011033282 6:82945041-82945063 TTGTGTTCTTCCCTTCAGGGTGG - Intronic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1011291095 6:85778473-85778495 TTGTGTCTTTCCCTTCAGAGTGG + Intergenic
1011386204 6:86801457-86801479 TTGTGTCTTTCCCTTGAGGGTGG + Intergenic
1011901413 6:92302626-92302648 CTGTGTTCTTCACTTTAGGGTGG - Intergenic
1012050002 6:94329120-94329142 CTGTGTCCTTCCCTTCACGTTGG - Intergenic
1012714355 6:102649447-102649469 CTGTGTCCTTCTCTTTAGTGTGG - Intergenic
1012717712 6:102698510-102698532 CTGTGTCCTTCCCTTCTGGATGG + Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1013687533 6:112602110-112602132 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1014186874 6:118445088-118445110 TTGTGTCCTTTCCTTCAGAGTGG + Intergenic
1014558433 6:122861785-122861807 TTGTGTCCTTCATTTAAATGAGG - Intergenic
1014583120 6:123162363-123162385 CTATGTCCTTTCCTTCAGGGCGG - Intergenic
1014840723 6:126217816-126217838 TTGTGTCCTTCCTTTCAGGGCGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1014928466 6:127303971-127303993 CTGTGTTCTTCCCTGCAGGGTGG - Intronic
1015030390 6:128587208-128587230 CTGTGTCCTTTTCTTCAGGGTGG - Intergenic
1015959526 6:138632297-138632319 CTGTGTCCTTGCCTTCAGGGTGG - Intronic
1016061505 6:139635988-139636010 CTGTTTCCTTCCCTTTGGGGAGG + Intergenic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1016151676 6:140748634-140748656 TTGTGTCCTTCCATTCAGAATGG - Intergenic
1016229870 6:141789496-141789518 TTGTGTCCTTCCCTTTAGCATGG - Intergenic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1016251642 6:142049618-142049640 GTGTGTCCTTTCCTTCTGGGTGG - Intergenic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1019196493 6:170286357-170286379 TTGTGTCCTGGCCCCAAGGGCGG - Intronic
1020573092 7:9890691-9890713 TTGTTTCCTTCCCTGCAGGGCGG - Intergenic
1020574736 7:9912741-9912763 TTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1021034876 7:15785375-15785397 TAGTGTCCTTCCCTTTAGGGTGG - Intergenic
1021130917 7:16912720-16912742 CTGTGTCCTTCCCTCCAGGGTGG + Intergenic
1021214513 7:17900380-17900402 TTGTGTCCTTCCCTTCAAGGTGG + Intronic
1021256200 7:18395565-18395587 TTCTCTCCTTCCCATAAGAGTGG - Intronic
1021353809 7:19628713-19628735 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1021676481 7:23085269-23085291 GTTTGTCCTTCCCTTGAGGCAGG + Intergenic
1021842643 7:24733185-24733207 CTGCATCCTTCCCTTAAGGCAGG - Intronic
1022348335 7:29539652-29539674 CTGTGCCCTTCCCTTTAGCGTGG - Intergenic
1022366887 7:29730267-29730289 TGGTGACCTTCCCTTCAGGGTGG + Intergenic
1022541945 7:31145899-31145921 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1022749796 7:33213081-33213103 TTGTGCCCTTCCCTTCAGGATGG + Intronic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1024662341 7:51510593-51510615 TTGCTTCCTTCCATTTAGGGTGG + Intergenic
1027524154 7:79245709-79245731 TCATGTCCTTCCCTTCAGGGTGG - Intronic
1028037134 7:85999123-85999145 TTGTGTCCTTCCCTTAATAGCGG + Intergenic
1028161009 7:87484324-87484346 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
1028264381 7:88705207-88705229 CTGTGTCCTTCCTTTCAGGATGG + Intergenic
1028521920 7:91741827-91741849 TAGTGTCCTTCCCTTAAAGATGG + Intronic
1028972682 7:96876034-96876056 TCATGCCCTTCCCTTCAGGGTGG - Intergenic
1029733637 7:102453661-102453683 TTGTGTCCTGCCCTTGACAGGGG - Exonic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1029825377 7:103187192-103187214 TGGTGACCTTCCCTTCAGGGTGG - Intergenic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030488574 7:110203595-110203617 TTGTGTTCTTCCCTTCAGGATGG + Intergenic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031231542 7:119114051-119114073 CTGTGTCATTCCCTTTAGGGTGG + Intergenic
1031238897 7:119213265-119213287 CTATGTGCTTCCCTTAACGGTGG + Intergenic
1031288293 7:119900403-119900425 TTGTGTTCTTCCCTTAGAGGTGG + Intergenic
1031462059 7:122063526-122063548 TTGTGTCCTTCCTCTCTGGGAGG - Intergenic
1031639039 7:124139837-124139859 CTGTGTCTTCCCCTTCAGGGCGG + Intergenic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1032138705 7:129307169-129307191 TTGTGCCTTTCCCTTCAGGGTGG + Intronic
1032917976 7:136512405-136512427 TGGTGTCCTTCCATGAAGCGGGG + Intergenic
1032972009 7:137175154-137175176 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034018970 7:147619756-147619778 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1034116672 7:148589672-148589694 TTATTGCCTTCCCTCAAGGGTGG + Intergenic
1034126488 7:148676109-148676131 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034581699 7:152049694-152049716 TTATGTCCTTTCCTTCAGGATGG + Intronic
1034990990 7:155548165-155548187 TTGTCTCCCTCTCGTAAGGGTGG - Intergenic
1036990902 8:13592690-13592712 ATGAGTCCTGCCCTTAAGGAAGG + Intergenic
1037295719 8:17397649-17397671 ATGTGTCCTTCCCTTCAGGGTGG - Intronic
1039115561 8:34088262-34088284 ATTTGTCCTTCCCTTGAGGCAGG - Intergenic
1039337714 8:36611137-36611159 TTCTGACCTTCCCTGAAGTGGGG + Intergenic
1039647380 8:39302935-39302957 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1041920011 8:63170800-63170822 TTGTGTACTTACCTTAAAGCGGG - Intronic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1043413768 8:80028355-80028377 TTATGGCCTTACCTTAAGGATGG + Intronic
1043760497 8:84062529-84062551 CTGTGTCTTTCGCTTCAGGGTGG + Intergenic
1044395144 8:91702675-91702697 CTGTGTCTCTCCCTTCAGGGTGG + Intergenic
1045124171 8:99071639-99071661 TTGTGTCTTTCCCTTCAGAGTGG + Intronic
1045159556 8:99523292-99523314 TTGTGTCCTTCCCTTCAGAGTGG - Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045592408 8:103613109-103613131 TTGGGTCCTTTCCTTCAGGGTGG + Intronic
1045800746 8:106097630-106097652 TTGTGTCCTATCCTTCAGGAAGG - Intergenic
1047234132 8:123024296-123024318 TTTTTTCCTTCCCTCAAAGGAGG + Intronic
1050103718 9:2144364-2144386 TTGTGTCCTTCGCTGGATGGGGG + Intronic
1050471745 9:5999925-5999947 CTGTGTCCATCCCTTAAGGGAGG + Intronic
1050578657 9:7027659-7027681 TTGTGTCCTGCCCTTCATGATGG + Intronic
1050865114 9:10488524-10488546 CTGTGTCCTTCCATTCAGGATGG + Intronic
1051455070 9:17246614-17246636 CTGTGTCCTTCCCTTCAGTACGG + Intronic
1051646130 9:19270327-19270349 TTGTGTTTTTCCCTTCAGGGTGG + Intronic
1052063393 9:23987548-23987570 CTGTGTCTTTCCCTTCAGGATGG - Intergenic
1052094047 9:24362827-24362849 TTGTTTCTTTCCTTTCAGGGTGG - Intergenic
1052258714 9:26490659-26490681 CTGTGTCCTTCCCTTCAAGATGG + Intergenic
1052605145 9:30689468-30689490 ATGTGTCCTCCCCGTGAGGGAGG - Intergenic
1052732977 9:32311105-32311127 TTCTGTCCTTCCCTCCAGAGTGG - Intergenic
1054982663 9:71223966-71223988 TTGTGTTCTTCCCTTTAGGGTGG - Intronic
1055302133 9:74892613-74892635 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1055756561 9:79564670-79564692 TTGTGTTTTATCCTTAAGGGAGG - Intergenic
1055827093 9:80339733-80339755 TTGTGTACTTTCCTTCAGGATGG - Intergenic
1056516834 9:87360009-87360031 TTGTTTCCTTCCCTTCAGGATGG - Intergenic
1057754435 9:97820535-97820557 TGCTGTCCTTCCCTGAAGGGGGG + Intergenic
1058522715 9:105828201-105828223 TTGTATCCTTCCTTTCATGGTGG + Intergenic
1058767881 9:108199276-108199298 CTGTGTCTTTTCCTTCAGGGTGG - Intergenic
1058820977 9:108728923-108728945 TTGTATCCTTTCTTTCAGGGTGG - Intergenic
1059041858 9:110823196-110823218 ATGTGTCCTTCCCTTCAAGCTGG - Intergenic
1059515466 9:114890055-114890077 CTGCATCCTTCCCTTCAGGGTGG - Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1059886678 9:118751895-118751917 TTGTGTCCTTCCCTTTAGGATGG - Intergenic
1059957460 9:119533142-119533164 TTGTTTCCTTCCTTTAGGAGAGG - Intergenic
1060084155 9:120681261-120681283 CTGGGTCCTTCCCTTGAAGGCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062581794 9:137232124-137232146 TTGTGTCCTTCAGCTGAGGGAGG - Exonic
1203654095 Un_KI270752v1:7052-7074 ATGTCTCCTTTCCTTAATGGTGG - Intergenic
1185923647 X:4122584-4122606 GTGTGTATTTCCCTTAAGGTAGG - Intergenic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1187323292 X:18261475-18261497 TTTCTTCCTCCCCTTAAGGGAGG - Intronic
1187610505 X:20938611-20938633 CTGTGCCCTTCCTTTCAGGGTGG + Intergenic
1188421047 X:29991395-29991417 TTATGTTCTTCTCTTTAGGGTGG + Intergenic
1188716322 X:33463805-33463827 TGGTGTCCTCTCCTTCAGGGAGG + Intergenic
1188815242 X:34705202-34705224 CTGTGTTCTTCACTTCAGGGCGG + Intergenic
1188846227 X:35076072-35076094 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1188864707 X:35300482-35300504 TTGTGCCCTTCCCTTTAGTTTGG - Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1189019676 X:37320916-37320938 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1189640862 X:43068690-43068712 TTGTGTTCTTTCCTTCAGGATGG - Intergenic
1189690487 X:43612686-43612708 CTGTGTTCTTCCCTTTAGGGTGG + Intergenic
1189854343 X:45208990-45209012 TTGTGTCCTTTCCTTCATGGTGG + Intergenic
1189870105 X:45372148-45372170 TTGTGTCCTTCCACTCAGGAAGG - Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1190010978 X:46784512-46784534 TGGTATCCTTCCCTTAAGGCTGG + Intergenic
1190037894 X:47042779-47042801 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1190368209 X:49717184-49717206 TTGTGTCCTTTCCTTCAGGGTGG + Intergenic
1190374262 X:49774199-49774221 TTGTGTTCTTTCCTTCAGGGTGG + Intergenic
1190808259 X:53860427-53860449 TTGTGTCTTTCCTTTCAGGGTGG + Intergenic
1191812319 X:65202813-65202835 TTGTGTCCTTCCTTTCCAGGTGG + Intergenic
1191834097 X:65445719-65445741 TTATGTCTTTCCCTTGAGGATGG + Intronic
1191892332 X:65956811-65956833 ATGTGTCCTCCCCGTGAGGGAGG + Intergenic
1191974049 X:66850990-66851012 GTGTGTTCTTCCCTTCAGAGTGG + Intergenic
1191988526 X:67008042-67008064 TTGTGTCTTTACTTTAATGGTGG + Intergenic
1192141370 X:68649571-68649593 TTGTGTCCTTCCTGTGGGGGTGG + Intronic
1192505565 X:71680087-71680109 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1192521502 X:71805048-71805070 CTGTGTCTTTCCCTTCAGGGTGG - Intergenic
1192640791 X:72859914-72859936 TTCTGTCCTTACTTTCAGGGCGG - Intergenic
1192640920 X:72860862-72860884 TTCTGTCCTTACTTTCAGGGCGG + Intergenic
1192714693 X:73627373-73627395 CTATGTCCTTCCCTTCAGGATGG + Intronic
1192812642 X:74560534-74560556 CTATGTCCTTTCCTTCAGGGTGG - Intergenic
1192826641 X:74704287-74704309 TTGTGTCCTCCCCTTCAAGGTGG + Intergenic
1192836204 X:74802138-74802160 CTGTGTCCTACCCTTCAGGGTGG - Intronic
1192891001 X:75390291-75390313 TTCTGTTCTTCCCTTCTGGGTGG - Intronic
1192908479 X:75578392-75578414 CTGTGTCCTTCCTTTCAGGGAGG + Intergenic
1192958717 X:76103742-76103764 TTGTATCCTTCCTTTTAGGGGGG + Intergenic
1192995408 X:76507322-76507344 ATGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193185129 X:78502495-78502517 TTGTGTCCTTCCTGTCAGGATGG - Intergenic
1193213977 X:78840514-78840536 TTGTGTCCTTCCATTCAGGGTGG - Intergenic
1193366172 X:80636991-80637013 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193455388 X:81725285-81725307 CTGTTTCCTTCCCTTCAGGGAGG - Intergenic
1193676148 X:84454653-84454675 TTGTGTCCTTTTCTTCAGGATGG - Intronic
1193683649 X:84552258-84552280 CTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193742422 X:85232870-85232892 TTGTGTTTTTCCCTTCAGGATGG - Intergenic
1193760825 X:85463097-85463119 CGGTGTTTTTCCCTTAAGGGTGG - Intergenic
1193765759 X:85527687-85527709 TTGTGTCTTTCCTTTCAGGGTGG + Intergenic
1193821420 X:86170411-86170433 TTGTGTTCTTCCCTTCAGGACGG + Intronic
1193830876 X:86288452-86288474 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
1193880075 X:86910917-86910939 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193911912 X:87316612-87316634 TTATGTCCTTGTCTTCAGGGTGG + Intergenic
1194016328 X:88625564-88625586 CTGTGTCATTCCCTTCAGAGCGG - Intergenic
1194037006 X:88887182-88887204 TGGTGACCTTCCCTTCAGAGTGG + Intergenic
1194136681 X:90152265-90152287 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1194223711 X:91227985-91228007 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1194354916 X:92870878-92870900 TTATCTCTTTCCCTTAAGTGTGG + Intergenic
1194481035 X:94424627-94424649 CTGTGTCCTTCCCTTCGGGGCGG + Intergenic
1194526563 X:94984089-94984111 TTGTGTCCTTCCCTCCAGGGTGG - Intergenic
1194550482 X:95291750-95291772 TTTTGTCTTTCCATTCAGGGTGG - Intergenic
1194561639 X:95428536-95428558 TTGTGTTTTTCCCTTCAGAGTGG - Intergenic
1194568510 X:95523021-95523043 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1194795964 X:98211153-98211175 TTGCGTCCTTCCCTTCAGAGTGG - Intergenic
1194857789 X:98956015-98956037 CTCTGTCTTTCCCTTCAGGGAGG + Intergenic
1194892466 X:99397706-99397728 TTATGTCCTTCACTTCATGGTGG + Intergenic
1194990793 X:100544382-100544404 ATGTGGCCTTCCCTTCAGGGTGG - Intergenic
1195401320 X:104464486-104464508 ATGTGGGCTTCCCTAAAGGGTGG + Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1195601364 X:106752134-106752156 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1195821096 X:108946183-108946205 GTATGTCCTTCCTTTCAGGGTGG + Intergenic
1195823413 X:108970982-108971004 TTGTGAACTTCCCTTCATGGTGG - Intergenic
1195917305 X:109948313-109948335 TTGTGTCTTTCCCTTCAAGGTGG - Intergenic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196096665 X:111808196-111808218 TTGTGTCTTTCCCTTCTGGGTGG + Intronic
1196232396 X:113239593-113239615 TTGTGTTCTTCCCTTTAGAGTGG + Intergenic
1196247468 X:113416180-113416202 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196399470 X:115299359-115299381 CTGTGTCCTTTCCTTCACGGTGG + Intronic
1196438282 X:115694335-115694357 TTTTCTCCTTCACTTTAGGGAGG - Intergenic
1196479855 X:116135572-116135594 TTGTGTCCTTCCCATCAAGGTGG + Intergenic
1196504280 X:116422867-116422889 CTGTGTCCTACCCTTAAAGTTGG - Intergenic
1196510058 X:116499042-116499064 ATGTGTCCTTCCCTACAGGATGG + Intergenic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1196579098 X:117358824-117358846 CTGTATTCTTCCCTTCAGGGTGG + Intergenic
1196590900 X:117484446-117484468 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1196625421 X:117871899-117871921 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1196639321 X:118039664-118039686 TTGTGTCCTTCCCTTCAGCATGG - Intronic
1197028260 X:121782174-121782196 CTGTTTCCTTCCCTTCAGGGTGG + Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197382696 X:125765215-125765237 TTGTATCCTTCTCTTCAGGGTGG + Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197470074 X:126856194-126856216 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1197600448 X:128520841-128520863 CTATGTCCTTCCCTTCAGGACGG - Intergenic
1197623463 X:128778603-128778625 TTGTGTTCTTCTCTTCAGGGTGG + Intergenic
1197646277 X:129021071-129021093 TAATGTCCTTCCCTTGAGTGTGG + Intergenic
1197661453 X:129178499-129178521 CTATGTCTTTCCCTTAAGGGAGG + Intergenic
1198430723 X:136564287-136564309 TTGTATCCTTCCCTTCAAGGTGG + Intergenic
1198462607 X:136877917-136877939 ATGTGTCCTCCCCGTGAGGGAGG + Exonic
1198697149 X:139354513-139354535 TTTTTTCCTTCCATTCAGGGTGG + Intergenic
1198788265 X:140314310-140314332 CTATGTCTTTCCCTTCAGGGTGG - Intergenic
1198841105 X:140859033-140859055 CTGTGTCCTTCCCTTCGTGGTGG - Intergenic
1198964558 X:142214248-142214270 TTGTGTCCTTCCCTTTACGGTGG + Intergenic
1199050652 X:143232857-143232879 CTGGGTCCTTTCCTTCAGGGTGG - Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1199159948 X:144597194-144597216 CTGGGTCCTTCCCTTTAAGGTGG + Intergenic
1199173671 X:144759262-144759284 CTGTTTCCTTCTCTTAATGGTGG - Intergenic
1199189527 X:144953493-144953515 TTGTGTCCCTCGTTTCAGGGTGG - Intergenic
1199239214 X:145526814-145526836 CTGTGTCCTTCCGTTCGGGGAGG - Intergenic
1199334258 X:146600151-146600173 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1199455113 X:148019974-148019996 TTGTATCCTTCCCTTCAGGGTGG + Intronic
1199457315 X:148043803-148043825 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1199475177 X:148237158-148237180 TTGTGTCCTTCCCCAAAGCATGG + Intergenic
1199908527 X:152260312-152260334 CTGTGTCCTTCCATTTGGGGTGG - Intronic
1200107129 X:153720727-153720749 CTGTGTCTTTCTCTTGAGGGAGG - Intronic
1200482428 Y:3722215-3722237 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1200560175 Y:4691367-4691389 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1200663276 Y:5987895-5987917 TTATCTCTTTCCCTTAAGTGTGG + Intergenic
1201496620 Y:14596123-14596145 TTGTATCCTTCCTATAAGTGAGG - Intronic
1202042713 Y:20701849-20701871 CTGGGTCCTTCCCTTCAGAGTGG - Intergenic
1202063456 Y:20912547-20912569 TTTTGTCCTTCCCTTGAGGCAGG - Intergenic
1202595511 Y:26535115-26535137 CTGTGTCCTTCCCTTCAGGATGG - Intergenic