ID: 945465019

View in Genome Browser
Species Human (GRCh38)
Location 2:210159131-210159153
Sequence CCTGATAATACCAATTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945465019 Original CRISPR CCTGATAATACCAATTTTGT AGG (reversed) Intronic
901534681 1:9874511-9874533 CCTGTTAATTCCAATATTTTGGG - Intronic
902100601 1:13984485-13984507 CCTAATAATTCTAATTTTTTTGG + Intergenic
905712587 1:40119141-40119163 CATGGTTATACCCATTTTGTTGG - Intergenic
907746302 1:57217081-57217103 CCTGAGAAGGCCAGTTTTGTAGG - Intronic
908363678 1:63395162-63395184 CCAGATAATACCTATTTCATAGG + Intronic
908979370 1:69935392-69935414 CATTATAATTCCAATTTGGTAGG - Intronic
909061449 1:70883081-70883103 TATGATGATACCCATTTTGTAGG + Intronic
910066974 1:83165607-83165629 CTTGATAATACCTGTCTTGTAGG - Intergenic
915020997 1:152778374-152778396 CCTGAGAATACTAATATTGAAGG - Intronic
915742644 1:158130920-158130942 AGTGATAATACCAAATTTATAGG + Intergenic
915828080 1:159100297-159100319 CCTTATAAAACCATTTGTGTTGG + Intronic
916258821 1:162819889-162819911 ACTGATACTACCAATTTGTTTGG - Intergenic
916627320 1:166572219-166572241 CAAGATAATACCAATGTTGTTGG + Intergenic
918590676 1:186237594-186237616 ACTCATAAGACCAATTTTGAGGG + Intergenic
918753231 1:188300325-188300347 TCTAATAGTGCCAATTTTGTGGG + Intergenic
922353997 1:224759150-224759172 GATGATAATACCAACTTTTTTGG + Intergenic
923737196 1:236621651-236621673 AATTATAGTACCAATTTTGTAGG - Intergenic
923941345 1:238831060-238831082 CCTGATAATAGCCATTCTATTGG + Intergenic
1066725268 10:38385557-38385579 ACTGATACTACCAATTTGTTTGG - Intergenic
1067930618 10:50557709-50557731 CCTAACAATACAAATTTTTTTGG - Intronic
1068673515 10:59746660-59746682 CCTGATAACCCCAAATTTGCCGG + Intergenic
1071948997 10:90681520-90681542 CCTAATAATTCCAATTATGAGGG - Intergenic
1074166445 10:110881120-110881142 CATGACATTACCATTTTTGTAGG - Intronic
1075527520 10:123199143-123199165 CCTGATCCTCCCATTTTTGTGGG + Intergenic
1076467167 10:130691010-130691032 CCTGACAATACTAATAATGTAGG + Intergenic
1079368419 11:19829582-19829604 CTTCATAATACCAATGATGTAGG + Intronic
1079855830 11:25602606-25602628 CTTTTTAATACCAATTTTCTGGG + Intergenic
1079866070 11:25735899-25735921 CCCCATAATTCCAATTTTCTAGG - Intergenic
1080563707 11:33488588-33488610 TATCATAATCCCAATTTTGTGGG + Intergenic
1086000322 11:81975855-81975877 ACTGTTAATACCTTTTTTGTTGG + Intergenic
1086194596 11:84122156-84122178 ACTGAAAATACAAATTTAGTTGG + Intronic
1087853245 11:103058061-103058083 TCTTATAATGCCAATTTTATTGG - Intergenic
1087979672 11:104595737-104595759 ACTGATAATACCAATTACCTGGG - Intergenic
1088128260 11:106455558-106455580 CCTGAGAATACCCACTTTCTAGG + Intergenic
1090499158 11:127244673-127244695 CCTTGTAATACAAATGTTGTAGG + Intergenic
1090565246 11:127984297-127984319 CCTCTTAATACCAAATTTCTGGG - Intergenic
1092596690 12:10013551-10013573 CCTGAGAATACAAACTTTATAGG + Intronic
1093544159 12:20326532-20326554 TCTAATAATACCTAATTTGTGGG - Intergenic
1094212440 12:27906462-27906484 GCAGATAATACCAGTATTGTAGG - Intergenic
1099583420 12:84483445-84483467 TCTGAGAAAACCAATTTTGGTGG - Intergenic
1099896140 12:88649509-88649531 CTTGATAATTTGAATTTTGTTGG + Intergenic
1100288903 12:93194740-93194762 ACTGCTAATACCAAGTTTGCAGG - Intergenic
1100351351 12:93786378-93786400 AATGATAATACCTCTTTTGTAGG + Intronic
1100546819 12:95611306-95611328 CTTGAAAATAACAATTTTGGGGG - Intergenic
1100920361 12:99477586-99477608 CATGATAATATCATGTTTGTGGG + Intronic
1101140907 12:101795157-101795179 CCTGGTAATACCAAAGTTGCTGG - Intronic
1101895337 12:108752282-108752304 CCTGCTACTAACAATTTTGGTGG - Intergenic
1104349091 12:128029422-128029444 CATGATGTTACCCATTTTGTAGG - Intergenic
1104787787 12:131460863-131460885 CCTGATAATACAAATTTATAGGG - Intergenic
1108531841 13:51334543-51334565 CATGATAATCCCATTTTAGTTGG + Intergenic
1110032727 13:70637265-70637287 CCTTATCATACTAAATTTGTAGG + Intergenic
1110620360 13:77587556-77587578 CCTGATAAGAGCAGTTTTGATGG - Intronic
1111229608 13:85326434-85326456 CCTCAAAATATGAATTTTGTGGG + Intergenic
1111914926 13:94350935-94350957 CCTGAGAAAGCCAAGTTTGTTGG - Intronic
1115876449 14:37867232-37867254 ACTGAGAACACCTATTTTGTAGG + Intronic
1117043572 14:51790355-51790377 CCTGAAATTGCCATTTTTGTAGG - Intergenic
1121189818 14:92016721-92016743 CATGATAATACCTATCTTGTAGG - Intronic
1125118877 15:36128922-36128944 CCTGTTGATCCCAATTTGGTGGG - Intergenic
1125145848 15:36467395-36467417 CCTGGTAAACCCAAGTTTGTTGG - Intergenic
1125528582 15:40395636-40395658 CCTGTTCATACCAGTTTTATTGG - Intergenic
1126935809 15:53706461-53706483 AATGATAGTACCAATTTTATAGG - Intronic
1131160944 15:90104407-90104429 CCTGATAATACCAGGTTGGCAGG - Intergenic
1135404066 16:22185562-22185584 CCTGCTAATCCCAATTTAATTGG - Intronic
1140541841 16:75762822-75762844 CTTCATAAAACTAATTTTGTAGG + Intergenic
1140928780 16:79608094-79608116 CCTGACAATGCCAAATTTGCAGG - Intergenic
1144904308 17:18627602-18627624 TTTGATAAGAGCAATTTTGTTGG - Intergenic
1146738725 17:35262499-35262521 CGTGATAATACCATGTTGGTTGG - Intronic
1148248906 17:46056726-46056748 ACTAATAATACCAATTTCATGGG + Intronic
1149129764 17:53284172-53284194 TCTAATAATATCAGTTTTGTTGG + Intergenic
1149773358 17:59338843-59338865 CCTGAAAATTCTGATTTTGTAGG - Intronic
1149938985 17:60842822-60842844 CCTAATAATACTGACTTTGTTGG + Intronic
1150477385 17:65485443-65485465 CATGATAATGCCAGTCTTGTAGG - Intergenic
1153230662 18:2932504-2932526 CCAGTTAATCTCAATTTTGTGGG - Intronic
1156333544 18:36148431-36148453 CCTAATATACCCAATTTTGTAGG + Intronic
1156598874 18:38580089-38580111 CCTGATAATTGAAGTTTTGTAGG - Intergenic
1156719768 18:40055948-40055970 CCTGCTAATACCACTTTTAGTGG - Intergenic
1157528233 18:48401401-48401423 GGTGATAATACCAATTTGATAGG - Intronic
1157548671 18:48565640-48565662 CATAATAGTACCTATTTTGTAGG + Intronic
1159008489 18:63035683-63035705 CCTAATAATATCTAATTTGTAGG + Intergenic
1159535556 18:69710346-69710368 CATGAGAATACCTATTTTGTAGG - Intronic
1163182159 19:15612101-15612123 TTAGATAATCCCAATTTTGTTGG - Intergenic
1164505830 19:28860501-28860523 CCTCATAATCCTAATCTTGTGGG + Intergenic
929937046 2:46300509-46300531 CTTGATAGTACCAGTTTTGGTGG + Intronic
930177963 2:48319413-48319435 CCAAATAATACCAATTTTATTGG + Intronic
938933919 2:136112044-136112066 CCAGATAATACCCATTTAGGAGG - Intergenic
939267257 2:139890202-139890224 TGTGATAATACCAATCTTGAAGG - Intergenic
940342882 2:152600005-152600027 CCTGACAAAACCACTTTTCTGGG - Intronic
942789451 2:179742318-179742340 ACTGGTAAAACCAATTTTCTAGG + Intronic
942874214 2:180773949-180773971 CATGATAATAAAAATTCTGTTGG - Intergenic
944916284 2:204364079-204364101 GCTGCTTCTACCAATTTTGTTGG + Intergenic
945465019 2:210159131-210159153 CCTGATAATACCAATTTTGTAGG - Intronic
945888193 2:215399621-215399643 ACAGATAATACCAATTCTGCTGG + Intronic
948505251 2:238423695-238423717 GCTGATAATACCCACTTTGCAGG - Intergenic
1168956827 20:1840404-1840426 CCTGATAGAAACACTTTTGTGGG - Intergenic
1172312674 20:33930425-33930447 CCTGATAATTCCATATTTGAGGG - Intergenic
1181336100 22:22130516-22130538 CTTGATAACAGCAATATTGTAGG - Intergenic
1184326527 22:43791678-43791700 CCTGATAGTAACAATGTTGGGGG + Intronic
949221147 3:1635472-1635494 ACTGATAATAGATATTTTGTTGG - Intergenic
952243159 3:31555145-31555167 AATTATAGTACCAATTTTGTGGG + Intronic
952784816 3:37142741-37142763 CGGGAGAAAACCAATTTTGTTGG + Intronic
952806631 3:37361357-37361379 CCTGATACTAACCATTTTGCTGG + Intronic
953523912 3:43670770-43670792 ACTGACAAGACTAATTTTGTTGG - Intronic
953873567 3:46649005-46649027 ACTGAAAATACAAAATTTGTCGG - Intergenic
957543349 3:81604745-81604767 CATGAAAATACCACTTTTGTAGG - Intronic
957726115 3:84069775-84069797 TCTTATAATACAAATTCTGTGGG - Intergenic
959114994 3:102165802-102165824 CCTGATAATACCCATTAGGGAGG + Intronic
959363185 3:105421448-105421470 CTTTAAATTACCAATTTTGTTGG - Intronic
959603622 3:108218497-108218519 CCTGATGATAGTAATTTTATGGG - Intronic
959729356 3:109583290-109583312 CCTGATAAGTCCAATGTTGCAGG + Intergenic
959813130 3:110642834-110642856 CCTGACAAGACTAACTTTGTGGG - Intergenic
963030464 3:140968413-140968435 ACTGATAATAGCAATTACGTAGG + Intronic
963654182 3:148024497-148024519 CCTCAAAATATAAATTTTGTGGG - Intergenic
964136737 3:153352888-153352910 CCTGATAGTACATATTTTCTAGG - Intergenic
964279308 3:155045655-155045677 CCTGAGAGTGTCAATTTTGTTGG + Intronic
964287317 3:155132442-155132464 CCATATAATAGCAGTTTTGTGGG - Intronic
964384597 3:156133929-156133951 CCAGTTAATAGCAATTTGGTGGG - Intronic
967418400 3:189244818-189244840 GATGATCATACCAATTCTGTTGG + Intronic
967466261 3:189809446-189809468 CCAGTTAAAACCAACTTTGTAGG - Intronic
968239266 3:197061148-197061170 CATGATAATTTCAATTTGGTGGG + Intronic
969842496 4:9892614-9892636 AATGATAATACCATTTTTGCAGG + Intronic
973948862 4:55989849-55989871 CTAGATAACACCAATTTTTTTGG - Intronic
975066420 4:70070490-70070512 CCTGATAATACAAATGTCCTGGG + Intergenic
975356486 4:73411958-73411980 CATGATAATACCATTTTGATTGG + Intronic
975920094 4:79375672-79375694 CTTGTTAACACCAACTTTGTAGG - Intergenic
976491063 4:85670930-85670952 CCAGAGATTTCCAATTTTGTAGG - Intronic
977254810 4:94728627-94728649 CCTGTTAATCACAATTTTCTTGG + Intergenic
978567289 4:110096898-110096920 GTTATTAATACCAATTTTGTTGG - Intronic
978623389 4:110657006-110657028 CCTGACAATAATAATTATGTTGG - Intergenic
978838536 4:113182723-113182745 CTTGATCATAGCAATTTTGGTGG + Intronic
979556854 4:122057658-122057680 TCTGATAATACCAAGGTTGGAGG - Intergenic
983186156 4:164703108-164703130 CATGATAATAGCAATGTTGGGGG - Intergenic
983291151 4:165807590-165807612 ACTGATAATACAAATTATTTGGG + Intergenic
983768249 4:171514690-171514712 CCTGTTAATACCCAGTTTGGGGG + Intergenic
984554902 4:181202050-181202072 CTTGATAAGACCATTTTTGCTGG - Intergenic
988253608 5:28794364-28794386 GCTGATGACACCAATTTGGTAGG - Intergenic
988639995 5:33031404-33031426 TCTTATAATAGCAATTTTTTGGG + Intergenic
990823336 5:59868700-59868722 CCTGATAAAAACAATCTTCTAGG + Intronic
990967267 5:61462777-61462799 GATAATAATACCTATTTTGTAGG - Intronic
993628169 5:90251190-90251212 CATGATATTACCAATATAGTGGG + Intergenic
995016910 5:107320192-107320214 CCAGATGTTACCAATTTTGATGG - Intergenic
995785253 5:115820756-115820778 CCTGATAAGACCTATTGTATAGG - Intergenic
996682291 5:126240566-126240588 CTTGATGATACCAGTGTTGTGGG - Intergenic
999811062 5:155127384-155127406 CCTGTCAGTCCCAATTTTGTGGG + Intergenic
1000449961 5:161373397-161373419 ACTGATAATACCAGTGCTGTTGG - Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1009815215 6:68724521-68724543 ACTTCTAATACAAATTTTGTGGG - Intronic
1012652535 6:101773610-101773632 ACTGATAATATCAATTTAGATGG - Intronic
1013566069 6:111364229-111364251 ACTGAAAATAACAGTTTTGTAGG + Intronic
1013761893 6:113528526-113528548 CCTTATAATTCTTATTTTGTAGG - Intergenic
1014637561 6:123866881-123866903 CCTAAAAATACCAAGTTTATGGG - Intronic
1016094263 6:140016845-140016867 CTTGATAATGCATATTTTGTTGG - Intergenic
1018279725 6:162172564-162172586 CCTTATAATCCCCATTTTGCAGG - Intronic
1022677862 7:32516584-32516606 CCTTTTAAAACTAATTTTGTTGG - Intronic
1024133890 7:46387155-46387177 CATGATGATATGAATTTTGTGGG - Intergenic
1024470377 7:49763754-49763776 TATGCTAATACCTATTTTGTTGG - Intergenic
1027277135 7:76569151-76569173 CTTGATAATACCTGTCTTGTAGG + Intergenic
1034024400 7:147683403-147683425 CCTGATAAGATAAGTTTTGTGGG + Intronic
1034894142 7:154864663-154864685 GCTGATAAAACCAGTTGTGTGGG + Intronic
1037789392 8:21923400-21923422 CCTGATTATACCTCTTTCGTGGG + Intronic
1039078903 8:33716922-33716944 ACTACTAATACCTATTTTGTAGG + Intergenic
1039535092 8:38302932-38302954 CCTGAAAATACCTATTTTAAAGG + Intronic
1043373836 8:79625435-79625457 CCTGGTGCTACCATTTTTGTTGG - Intronic
1044874016 8:96646233-96646255 CCTGGTATTTCCATTTTTGTTGG + Intronic
1047567140 8:126057674-126057696 CCTAATTATACCTATTTTGTGGG - Intergenic
1050619434 9:7437183-7437205 TCTCATAATCCCAATCTTGTAGG + Intergenic
1052680006 9:31678994-31679016 ACTGATATTACCAATGTTATAGG + Intergenic
1058611430 9:106780383-106780405 CTTGATAAATCCTATTTTGTAGG - Intergenic
1058636000 9:107039232-107039254 CCAGATAATACCTATTCTGCAGG + Intergenic
1059613583 9:115924833-115924855 CTTGATAACAACAATTTTGGTGG - Intergenic
1060353884 9:122885521-122885543 CATTATAGTTCCAATTTTGTTGG - Intronic
1187817529 X:23248968-23248990 GAGGATAAAACCAATTTTGTTGG - Intergenic
1188060510 X:25595463-25595485 GATAATAATACCTATTTTGTAGG + Intergenic
1188947242 X:36320904-36320926 CCTAGTAATGCCAATTCTGTTGG + Intronic
1193384480 X:80854563-80854585 CCTTTTCAAACCAATTTTGTTGG + Intergenic
1194160576 X:90445650-90445672 CCTGGAAACACCAATGTTGTTGG - Intergenic
1196622995 X:117845226-117845248 ACTGATAATACCTACTTTTTTGG - Intergenic
1198686620 X:139234406-139234428 CATGATAATTCCTATTTTGCAGG + Intergenic
1200506867 Y:4022580-4022602 CCTGCAAACACCAATTTTGTTGG - Intergenic
1201541841 Y:15113438-15113460 CATGATAAGACCACTTATGTGGG + Intergenic