ID: 945482287

View in Genome Browser
Species Human (GRCh38)
Location 2:210357986-210358008
Sequence GAGGGCAAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945482287 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr