ID: 945485144

View in Genome Browser
Species Human (GRCh38)
Location 2:210386601-210386623
Sequence AAATGTTTGTAAAATTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485143_945485144 12 Left 945485143 2:210386566-210386588 CCTAAAAAATGCTTTTAATAACT No data
Right 945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485144 Original CRISPR AAATGTTTGTAAAATTCTGA AGG Intergenic
No off target data available for this crispr