ID: 945485427

View in Genome Browser
Species Human (GRCh38)
Location 2:210389944-210389966
Sequence GTAAATTGCTTGACATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485423_945485427 12 Left 945485423 2:210389909-210389931 CCAGGTTCCAATACTTACAAATG No data
Right 945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG No data
945485425_945485427 5 Left 945485425 2:210389916-210389938 CCAATACTTACAAATGGTATGAT No data
Right 945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485427 Original CRISPR GTAAATTGCTTGACATCTCT GGG Intergenic
No off target data available for this crispr