ID: 945485440

View in Genome Browser
Species Human (GRCh38)
Location 2:210390068-210390090
Sequence TAGCAGGGAGGCAGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485440_945485445 21 Left 945485440 2:210390068-210390090 CCTGGCTTCCTGCCTCCCTGCTA No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485440 Original CRISPR TAGCAGGGAGGCAGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr