ID: 945485442

View in Genome Browser
Species Human (GRCh38)
Location 2:210390080-210390102
Sequence TCAATTGCGCACTAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485442_945485445 9 Left 945485442 2:210390080-210390102 CCTCCCTGCTAGTGCGCAATTGA No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485442_945485446 28 Left 945485442 2:210390080-210390102 CCTCCCTGCTAGTGCGCAATTGA No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485442 Original CRISPR TCAATTGCGCACTAGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr