ID: 945485443

View in Genome Browser
Species Human (GRCh38)
Location 2:210390083-210390105
Sequence AGTTCAATTGCGCACTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485443_945485446 25 Left 945485443 2:210390083-210390105 CCCTGCTAGTGCGCAATTGAACT No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data
945485443_945485445 6 Left 945485443 2:210390083-210390105 CCCTGCTAGTGCGCAATTGAACT No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485443 Original CRISPR AGTTCAATTGCGCACTAGCA GGG (reversed) Intergenic
No off target data available for this crispr