ID: 945485444

View in Genome Browser
Species Human (GRCh38)
Location 2:210390084-210390106
Sequence AAGTTCAATTGCGCACTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485444_945485445 5 Left 945485444 2:210390084-210390106 CCTGCTAGTGCGCAATTGAACTT No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485444_945485446 24 Left 945485444 2:210390084-210390106 CCTGCTAGTGCGCAATTGAACTT No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485444 Original CRISPR AAGTTCAATTGCGCACTAGC AGG (reversed) Intergenic
No off target data available for this crispr