ID: 945485445

View in Genome Browser
Species Human (GRCh38)
Location 2:210390112-210390134
Sequence TTGTTCATTTTATTGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485440_945485445 21 Left 945485440 2:210390068-210390090 CCTGGCTTCCTGCCTCCCTGCTA No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485441_945485445 13 Left 945485441 2:210390076-210390098 CCTGCCTCCCTGCTAGTGCGCAA No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485442_945485445 9 Left 945485442 2:210390080-210390102 CCTCCCTGCTAGTGCGCAATTGA No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485443_945485445 6 Left 945485443 2:210390083-210390105 CCCTGCTAGTGCGCAATTGAACT No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data
945485444_945485445 5 Left 945485444 2:210390084-210390106 CCTGCTAGTGCGCAATTGAACTT No data
Right 945485445 2:210390112-210390134 TTGTTCATTTTATTGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485445 Original CRISPR TTGTTCATTTTATTGAGAGC AGG Intergenic
No off target data available for this crispr