ID: 945485446

View in Genome Browser
Species Human (GRCh38)
Location 2:210390131-210390153
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485443_945485446 25 Left 945485443 2:210390083-210390105 CCCTGCTAGTGCGCAATTGAACT No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data
945485442_945485446 28 Left 945485442 2:210390080-210390102 CCTCCCTGCTAGTGCGCAATTGA No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data
945485444_945485446 24 Left 945485444 2:210390084-210390106 CCTGCTAGTGCGCAATTGAACTT No data
Right 945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type