ID: 945485785

View in Genome Browser
Species Human (GRCh38)
Location 2:210394376-210394398
Sequence CTGAAACAGAAATGGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945485785_945485788 -10 Left 945485785 2:210394376-210394398 CCATGAATCCATTTCTGTTTCAG No data
Right 945485788 2:210394389-210394411 TCTGTTTCAGGATCCAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945485785 Original CRISPR CTGAAACAGAAATGGATTCA TGG (reversed) Intergenic
No off target data available for this crispr