ID: 945492885

View in Genome Browser
Species Human (GRCh38)
Location 2:210476659-210476681
Sequence GCGCACTTGCTTCAAGTCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945492885_945492897 30 Left 945492885 2:210476659-210476681 CCCGCGACTTGAAGCAAGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 945492897 2:210476712-210476734 GGCCTCTCACCCCGCAGCCCCGG 0: 1
1: 0
2: 8
3: 53
4: 467
945492885_945492890 3 Left 945492885 2:210476659-210476681 CCCGCGACTTGAAGCAAGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 945492890 2:210476685-210476707 CCGCGTCCTGAAGCCCTTCTCGG 0: 1
1: 0
2: 1
3: 12
4: 93
945492885_945492892 9 Left 945492885 2:210476659-210476681 CCCGCGACTTGAAGCAAGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945492885 Original CRISPR GCGCACTTGCTTCAAGTCGC GGG (reversed) Exonic