ID: 945492892

View in Genome Browser
Species Human (GRCh38)
Location 2:210476691-210476713
Sequence CCTGAAGCCCTTCTCGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945492883_945492892 15 Left 945492883 2:210476653-210476675 CCCACGCCCGCGACTTGAAGCAA 0: 1
1: 0
2: 0
3: 1
4: 17
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492884_945492892 14 Left 945492884 2:210476654-210476676 CCACGCCCGCGACTTGAAGCAAG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492882_945492892 20 Left 945492882 2:210476648-210476670 CCGTTCCCACGCCCGCGACTTGA 0: 1
1: 0
2: 0
3: 0
4: 51
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492885_945492892 9 Left 945492885 2:210476659-210476681 CCCGCGACTTGAAGCAAGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492880_945492892 22 Left 945492880 2:210476646-210476668 CCCCGTTCCCACGCCCGCGACTT 0: 1
1: 0
2: 0
3: 0
4: 47
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492881_945492892 21 Left 945492881 2:210476647-210476669 CCCGTTCCCACGCCCGCGACTTG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201
945492886_945492892 8 Left 945492886 2:210476660-210476682 CCGCGACTTGAAGCAAGTGCGCC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945492892 Original CRISPR CCTGAAGCCCTTCTCGGCCC TGG Exonic
900185700 1:1332197-1332219 CCTGAGCATCTTCTCGGCCCTGG + Exonic
900344999 1:2206272-2206294 CCTGCAGCCCTGCACAGCCCCGG + Intronic
900360632 1:2287183-2287205 CCTGGAGCCCCGCACGGCCCAGG - Intronic
900400893 1:2472461-2472483 CCTGCAGCCCTTCCTGGCCCTGG - Intronic
900829001 1:4950673-4950695 CCTGCAGCCCCTCTCGCCCTGGG - Intergenic
901079302 1:6574861-6574883 CATCATGCCCTTCTCTGCCCAGG + Exonic
905404320 1:37722931-37722953 CCTGAAGCCCACCTCCACCCAGG - Intronic
906729527 1:48069346-48069368 CCTGCTGCCCTCCTCGGCTCTGG - Intergenic
914869404 1:151459973-151459995 CCTCAAGCCCTTCTGGATCCTGG + Intergenic
915090052 1:153417845-153417867 CCTGCATCTCTTCTTGGCCCTGG + Intronic
915596791 1:156900818-156900840 CCTGGACCCCTGCTCTGCCCTGG - Intronic
919775681 1:201192603-201192625 TCTTAAGCTCTTCTTGGCCCAGG - Intronic
921984331 1:221294660-221294682 CATGAAGCCCTTCTGAGCTCAGG + Intergenic
922730470 1:227946708-227946730 CCTGCAGGGCTCCTCGGCCCAGG + Intronic
924028226 1:239860483-239860505 CCTGAAACTCTTCTGGTCCCAGG - Intronic
924690495 1:246345434-246345456 CCTGAAGCACTTCTGGTCCCAGG - Intronic
1064686698 10:17869052-17869074 CCTGATACCCTTCTCTGCTCTGG - Intronic
1065616490 10:27531345-27531367 GCTGAAGCCCCTCACGCCCCTGG + Intronic
1071601379 10:86960163-86960185 CCAGCAGCCTTTCTGGGCCCAGG - Intronic
1072521097 10:96230758-96230780 CCTGATGCCCTCCTGGTCCCAGG + Intronic
1074377695 10:112952424-112952446 CCTGCTGCCCTGCGCGGCCCGGG - Intronic
1075103917 10:119524671-119524693 CCTGGGGCCCCTCTCTGCCCAGG + Intronic
1075717884 10:124567337-124567359 CCCGCAGCCCTGGTCGGCCCGGG - Intronic
1075884250 10:125883862-125883884 CCTGGAGCCCTGCTCTTCCCTGG + Intronic
1076175719 10:128366406-128366428 TCTGAAGCAATTCTCTGCCCGGG - Intergenic
1076612737 10:131736785-131736807 CCTGACTCCCTGCTGGGCCCTGG - Intergenic
1076998286 11:310118-310140 TCTGAACCCCTACTCGACCCAGG + Intronic
1077254693 11:1574874-1574896 CCTGAAGCTCCTCTCGCCTCCGG + Intergenic
1077396649 11:2327116-2327138 CCTGTAGCAGTTCTCGGCCTGGG + Intergenic
1079314987 11:19399901-19399923 CCTGAAGCCCATCTGACCCCAGG - Intronic
1084683936 11:70682721-70682743 CCTGGAGCCCTTGTCCTCCCAGG + Intronic
1085388994 11:76172626-76172648 CCTGAACCCCTTCTTGGCCCAGG + Intergenic
1087434934 11:98102639-98102661 CCTGCTCCCCTTCTCGCCCCTGG - Intergenic
1089258423 11:117206401-117206423 CCTACAGCCTTTCTCAGCCCAGG + Intronic
1091209204 11:133842262-133842284 CCTGAAGCCCTTCTGTGCACTGG + Intronic
1091367844 11:135037238-135037260 CATGAGTCCCTTGTCGGCCCCGG - Intergenic
1091992420 12:4966414-4966436 CTTGAAACTCTACTCGGCCCAGG - Intergenic
1095465328 12:42483404-42483426 CCTGCAGCCCCTCGCGGCGCCGG + Intronic
1096298115 12:50401158-50401180 GCTGCAGGCCTGCTCGGCCCAGG - Intronic
1096993433 12:55823461-55823483 CTTGAAGGCCTCCTCAGCCCGGG + Exonic
1101639985 12:106580995-106581017 CCTGGCGCCCTTCTGGGCACTGG + Intronic
1101764021 12:107682307-107682329 CCTGATGCCATTCATGGCCCTGG + Intergenic
1102981768 12:117247348-117247370 CTTGAAGACCTTCTTGGCCCAGG + Exonic
1103277502 12:119724977-119724999 TCTGAAGCCATTTTGGGCCCAGG + Intronic
1105011824 12:132761546-132761568 CCCGACGCCCTCCTCGGGCCTGG - Intronic
1105786818 13:23758182-23758204 TCTGAGGCCCTTCTCAGCCATGG + Intronic
1106575277 13:30968690-30968712 CCTGCAGCTCTGCTCAGCCCTGG + Intronic
1108027306 13:46191458-46191480 TGTGAAGCCCTTCTGGGCACAGG + Intronic
1110679003 13:78285556-78285578 TCTGAAGCCCTCCTCAGCTCAGG + Intergenic
1112368288 13:98773923-98773945 TCCTCAGCCCTTCTCGGCCCGGG - Intergenic
1112822297 13:103351259-103351281 CCTGGATCCCTTCCCGACCCCGG - Intergenic
1113538918 13:111091830-111091852 CCTGAAGCCCTCATCGCCACTGG + Intergenic
1113616094 13:111681595-111681617 CCAGAAACCCTCCTCTGCCCTGG - Intergenic
1113621562 13:111766488-111766510 CCAGAAACCCTCCTCTGCCCTGG - Intergenic
1113655513 13:112066288-112066310 CCTGCATCCGTTCTCGGCCGCGG - Intergenic
1114075844 14:19160770-19160792 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1114086319 14:19238802-19238824 CCTGATGCCCATCTGGGCACTGG - Intergenic
1114669832 14:24403934-24403956 CCTGAAGCTGTTCTGGTCCCTGG + Intronic
1122362985 14:101178416-101178438 CCTGGAGCCCTGCTGGGCCAGGG - Intergenic
1122581296 14:102773329-102773351 GCTGGTGCCCTTCTCGGGCCAGG - Intergenic
1202897860 14_GL000194v1_random:20421-20443 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1129647497 15:77450070-77450092 CCTGAAACACTTCTGGTCCCAGG - Intronic
1131144075 15:90000539-90000561 CCTGAGCCCCTTCTCCACCCGGG + Intergenic
1132135861 15:99337926-99337948 CCTGAAGCAATGCTCTGCCCTGG + Intronic
1132750414 16:1454974-1454996 CCTGCAGCCCCTCGGGGCCCTGG + Intronic
1132841424 16:1980066-1980088 CCTGCAGCCCTTCTGTACCCAGG - Exonic
1133279090 16:4655113-4655135 CCTGGTGCCCTCCTCGGGCCTGG + Intronic
1133578126 16:7114639-7114661 CATGAGGCACTTCTCAGCCCAGG - Intronic
1134410785 16:14001671-14001693 CTTGAAGCCCGTCTCTTCCCTGG - Intergenic
1135409168 16:22220294-22220316 CCTGACGTTCTCCTCGGCCCTGG - Intronic
1135436287 16:22428823-22428845 CCAGAGGCCCATCTGGGCCCTGG + Intronic
1137888213 16:52129261-52129283 CCTCAAGGGCTTCACGGCCCAGG - Intergenic
1140033977 16:71359160-71359182 CCTGGAGGCCTTCCCAGCCCAGG - Intronic
1142045503 16:87922656-87922678 CCAGAGGCCCGTCTGGGCCCTGG + Intronic
1142288902 16:89183711-89183733 CTTGCAGCCCCTCCCGGCCCGGG - Intronic
1142987820 17:3707645-3707667 CCAGACCCCCCTCTCGGCCCTGG + Intergenic
1147536420 17:41325482-41325504 CCTGGAGGCCTCCTGGGCCCGGG - Intergenic
1148145936 17:45364902-45364924 CCAGGAGCCCATCTCGGGCCTGG - Intergenic
1148325728 17:46782459-46782481 GGTGGAGCCCTTCTGGGCCCAGG - Intronic
1148777141 17:50102152-50102174 CCTGAAGCCCCTCAGGGGCCTGG - Intronic
1149142351 17:53447701-53447723 CCAGCAGCACTTCTCAGCCCAGG + Intergenic
1149578015 17:57727652-57727674 CCTGCAGCACCTCTCAGCCCTGG - Intergenic
1151493231 17:74444707-74444729 CCGGAAGCTCTCCTCTGCCCAGG - Intronic
1152881932 17:82822548-82822570 CCTGAAGCCCCTCTAGGATCTGG - Intronic
1159040254 18:63318285-63318307 CCTGACGCCCTTCACCGCGCGGG - Exonic
1160665240 19:325082-325104 CCTGGAGCCCTTGCAGGCCCTGG - Intronic
1161055499 19:2188854-2188876 CCGGAAGCCCCTCTGAGCCCAGG + Intronic
1161447948 19:4328532-4328554 CCAGACGCCCGTCTCGGCTCTGG + Intronic
1161976481 19:7610636-7610658 CCAGATGCCCGCCTCGGCCCAGG - Intronic
1164753696 19:30674198-30674220 CCTGAAAGCCTTCTCCACCCAGG - Intronic
1165229590 19:34378653-34378675 CCTGAGGCTCTCTTCGGCCCAGG - Intronic
1165812108 19:38617923-38617945 CCTGAGGCCCTGCTGGCCCCTGG - Exonic
1168056196 19:53866572-53866594 CCTGCATCCCTTCCCTGCCCTGG + Intronic
1168613740 19:57821232-57821254 CCTGAACCCTTTCTTGTCCCTGG - Intronic
1168617728 19:57851937-57851959 CCTGAACCCTTTCTTGTCCCTGG - Intronic
1168625524 19:57915088-57915110 CCTGAACCCTTTCTTGTCCCTGG + Intronic
925897876 2:8487419-8487441 CATGCAGCCGTTGTCGGCCCCGG - Intergenic
926332157 2:11834493-11834515 CCTGAATCACTTCTGGGCCAAGG + Intergenic
928093663 2:28391587-28391609 CCTTAGGCCCTTCTCTGCTCTGG - Intergenic
928214924 2:29353269-29353291 CCTGAAGCTCTTCTAAGCACAGG - Intronic
929238784 2:39632206-39632228 CCTGAATCCCTTCAAGGCCAGGG - Intergenic
932111595 2:69006668-69006690 CCCCAAGCCCTTCTGTGCCCTGG + Intergenic
932424292 2:71619449-71619471 GGTGAAGCCCTGCTGGGCCCAGG - Intronic
933638416 2:84732234-84732256 TCTGAAACACTTCTGGGCCCAGG - Intronic
937908289 2:127063381-127063403 CCTGCTGCCCTCCTGGGCCCAGG + Intronic
937910030 2:127071040-127071062 CCAGATGCCATTCTCAGCCCAGG + Intronic
937962356 2:127469924-127469946 CCTAGAGCCCTTCTCTCCCCAGG + Intronic
938490438 2:131758288-131758310 CCTGATGCCCATCTGGGCCCTGG + Intronic
938595255 2:132782525-132782547 CCTGAAGCCCTGCAGAGCCCAGG - Exonic
941891361 2:170585310-170585332 CCTGAAACTCTTCTTGGCTCAGG - Intronic
944494351 2:200291252-200291274 CCTGAAGCCATTCTTAGGCCAGG - Intergenic
945371771 2:209027212-209027234 CCTGAAGCCAATATTGGCCCTGG - Intergenic
945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG + Exonic
946434860 2:219644720-219644742 CCTGAAGCCCTTTGTAGCCCCGG + Intergenic
1168821245 20:775075-775097 CCTGAAGCCCTTCCTGGCCTTGG - Intergenic
1170799865 20:19582220-19582242 CCTGGAGGGCCTCTCGGCCCTGG + Intronic
1174130328 20:48339936-48339958 CCTGGACCCCTTCTCTGCCTGGG + Intergenic
1174475962 20:50795517-50795539 CCTGAGGCGCCGCTCGGCCCGGG - Intronic
1175691753 20:61070359-61070381 CCTGAAGCCTTTTTCAGCCCTGG + Intergenic
1175927907 20:62480050-62480072 CCAGAAGCCCCTCACAGCCCAGG - Intergenic
1176408899 21:6437147-6437169 CCAGAAGCCCTTGTGGGCCTCGG - Intergenic
1176454796 21:6898863-6898885 CGTGAAGCCGTTCTTGCCCCTGG - Intergenic
1176617544 21:9036410-9036432 CCTGATGCCCATCTGGGCGCTGG - Intergenic
1176707601 21:10127260-10127282 CCTGATGCCCATCTGGGTCCTGG + Intergenic
1176832969 21:13763911-13763933 CGTGAAGCCGTTCTTGCCCCTGG - Intergenic
1177431641 21:20998060-20998082 CCCCACGCCCTTCTCGGCTCAGG + Intergenic
1179269725 21:39841388-39841410 CCTCATGCCCTGCTCAGCCCAGG + Intergenic
1179684392 21:43045469-43045491 CCAGAAGCCCTTGTGGGCCTCGG - Intergenic
1179719127 21:43305554-43305576 CCTCCTGCCCTGCTCGGCCCCGG + Intergenic
1180291544 22:10853934-10853956 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1180494349 22:15883356-15883378 CCTGATGCCCATCTGGGCGCTGG + Intergenic
1180793726 22:18591824-18591846 TCTGAGGCCCTGCTGGGCCCTGG - Intergenic
1181051453 22:20240113-20240135 TCTGCAGCCCCTCTGGGCCCAGG - Intergenic
1181228014 22:21403496-21403518 TCTGAGGCCCTGCTGGGCCCTGG + Intergenic
1181250639 22:21531343-21531365 TCTGAGGCCCTGCTGGGCCCTGG - Intergenic
1182441310 22:30365905-30365927 CCTGAAACCCTCATCTGCCCAGG - Intronic
1183405549 22:37628948-37628970 GCTGAAGGCCCTCTTGGCCCTGG - Intronic
949348223 3:3097306-3097328 CCAGAAGCCCTTCTTCTCCCAGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950180940 3:10912674-10912696 CCTGAACCCCCTCCCAGCCCTGG - Intronic
953569185 3:44057854-44057876 CCTGAAGCCATTCACGTTCCTGG - Intergenic
953580844 3:44154871-44154893 CCTGGAGCCCTTCTGTGCCTTGG + Intergenic
953670642 3:44959163-44959185 CCTGCTGGCCTTCTTGGCCCTGG - Exonic
954753539 3:52826952-52826974 CCTGATGCCCTTCTCCCCCAGGG - Exonic
956527603 3:70182072-70182094 CCTCCAGCCCATCTCGGGCCTGG - Intergenic
960884986 3:122384363-122384385 CCTGAAGCCTTCCTGGGCCCCGG + Intronic
961392247 3:126559019-126559041 CCTGAAGCCCCTCTGGCCCAGGG + Intergenic
964790470 3:160449812-160449834 CCTGAAGCCCTTCGGGGCAGAGG - Exonic
968956779 4:3723532-3723554 CCAAAAGCGCTTCTGGGCCCAGG + Intergenic
969600937 4:8176056-8176078 CCTGGAGCCCGTCTCCGCACAGG - Intergenic
971203435 4:24535619-24535641 AATGGAGCCCTTCTCTGCCCAGG - Intronic
971366702 4:25983445-25983467 CCTGGACACCTTCTCAGCCCTGG + Intergenic
974981168 4:68959300-68959322 CCTTAAGCACTTTTCTGCCCTGG + Intergenic
983936001 4:173503024-173503046 CCTCAAACCCTTCTCAGCTCAGG + Intergenic
988564769 5:32312488-32312510 CCGCAATCCCTTCTCGGCTCGGG + Intronic
991973988 5:72168073-72168095 CCTGAGGCCCTCCTCAGCTCAGG - Intronic
997510140 5:134448368-134448390 CCTGTAGCCTTTCTGGGCACTGG - Intergenic
997981003 5:138467259-138467281 CCAGAAGCCCTTCCAGGGCCTGG + Exonic
1001708654 5:173760489-173760511 CCTGAAGCCCTACTCAGTACTGG + Intergenic
1001963779 5:175896047-175896069 CCTGATGCCTTTCTCAGCCCAGG + Intergenic
1002176153 5:177402624-177402646 CCTGGAGCGCTGCTCAGCCCCGG - Exonic
1002340421 5:178513149-178513171 GCTGAAGCTCATCTCGTCCCAGG - Intronic
1002435475 5:179228452-179228474 CCTGAAGACCTCCGGGGCCCTGG + Intronic
1003240186 6:4337846-4337868 CCTGAAACTCTTCTGGTCCCAGG - Intergenic
1003798067 6:9628573-9628595 ACTGAACCCCTTCTTGGCCAAGG - Intronic
1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG + Intergenic
1007727288 6:43924123-43924145 CATGAAGCCATTCTTGGCCAGGG - Intergenic
1010123366 6:72405503-72405525 CCTGAAGCCATTCTCCCCCTGGG + Intergenic
1010326372 6:74567722-74567744 CCTGAATCCCTTCTCGCTCAGGG - Intergenic
1010437460 6:75850178-75850200 CCTGAGCCCCTACTCGACCCAGG + Intronic
1013368184 6:109450070-109450092 ACTGCAGCCCTTCTGGCCCCTGG - Exonic
1013606340 6:111752565-111752587 CCTGATGCCCATCTTTGCCCTGG - Intronic
1015999933 6:139031788-139031810 CCTGAACTGCTTCTGGGCCCAGG + Intronic
1016558611 6:145368970-145368992 CCTGAACCCCATCACAGCCCTGG + Intergenic
1016657960 6:146543419-146543441 CCTGGAGCCTTTATGGGCCCCGG - Intergenic
1018354476 6:162998335-162998357 CCTGAAGGCTTTCTCAGTCCTGG - Intronic
1018960899 6:168448012-168448034 CCTGAAGGCTTTCCCTGCCCAGG + Intronic
1019443143 7:1057423-1057445 CCTGCAGCACTTCTGGGCCAGGG + Intronic
1021264650 7:18505091-18505113 CCTTAAGCTCCTCTCAGCCCTGG - Intronic
1021622644 7:22563667-22563689 CCCGAAGCCCAGCTCTGCCCTGG - Intronic
1023081884 7:36533978-36534000 CCTGCCGCCCCTCTGGGCCCTGG + Intronic
1025263879 7:57440024-57440046 CCTGAGGCCCTTGTGGGCCCTGG + Intergenic
1025635354 7:63316085-63316107 CCTGAGGACCTTGTGGGCCCTGG - Intergenic
1025647340 7:63432085-63432107 CCTGAGGACCTTGTGGGCCCTGG + Intergenic
1029114587 7:98230749-98230771 CCAGAAGCCCCACTGGGCCCAGG - Intronic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1029687197 7:102157017-102157039 CCTGAATGCCTTCTCGTCCCAGG - Intronic
1030570281 7:111213490-111213512 CCTGAAGCCCTCCAGGGGCCAGG + Intronic
1032272898 7:130427820-130427842 CCTGATGTCTTTCTCGGCTCAGG - Intronic
1033619333 7:143048421-143048443 CCTCCAGCCCTGCTCTGCCCAGG + Intergenic
1035938987 8:3875091-3875113 CCTGAAGCCCCTCTAGGATCTGG - Intronic
1037483823 8:19329043-19329065 TCTGGTGCCCCTCTCGGCCCTGG + Intronic
1037627098 8:20617864-20617886 CCTGGAGCCCTTCACAGTCCAGG - Intergenic
1037689162 8:21168360-21168382 CCTGCAGCCCTCATCGGCCCGGG + Intergenic
1039621104 8:38997341-38997363 CCCCAAGCCCTTCTTGGCCCGGG + Intronic
1040559991 8:48515129-48515151 CCGGAAGCCGTTCTCAGTCCTGG - Intergenic
1042258514 8:66831854-66831876 CCAGATACCCTTCTGGGCCCTGG + Intronic
1047521650 8:125599563-125599585 CCATAAGCCCTTCTCTGCCAGGG + Intergenic
1047984701 8:130220757-130220779 CCTGAGGCCCTCCTCAGCCATGG - Intronic
1048360517 8:133693686-133693708 GCTGAAGCCATTCTAGGCCCTGG + Intergenic
1048779879 8:137989081-137989103 TCTGAGCCCCTTCTCGACCCAGG - Intergenic
1048991816 8:139764981-139765003 CCTGAAGACCTACTGTGCCCTGG - Intronic
1051369481 9:16346013-16346035 CCTGGCACTCTTCTCGGCCCTGG - Intergenic
1053644797 9:40113997-40114019 CCTGATGCCCATCTGGGCCCTGG + Intergenic
1053761188 9:41350854-41350876 CCTGATGCCCATCTGGGCCCTGG - Intergenic
1054325818 9:63711877-63711899 CCTGATGCCCATCTGGGCCCTGG + Intergenic
1054539779 9:66261972-66261994 CCTGATGCCCATCTGGGCCCTGG - Intergenic
1055044412 9:71910475-71910497 CCGGGATCCCTTCTCGGCACAGG - Intronic
1057075261 9:92135199-92135221 CCCGAATCACTTCTCTGCCCAGG + Intergenic
1061234320 9:129333802-129333824 CCTCAAGGCCTTCTGGGACCTGG + Intergenic
1062181885 9:135195318-135195340 CCAGAGGCCCTTCCCTGCCCTGG + Intergenic
1202792347 9_KI270719v1_random:96140-96162 CCTGATGCCCATCTGGGTCCTGG + Intergenic
1185473627 X:400106-400128 CCTGAACTCCCTCTCAGCCCTGG + Intergenic
1185786860 X:2898239-2898261 CCTGAAGCCCCTCCCAGGCCCGG + Intergenic
1187796188 X:23006577-23006599 CCTGCAGCACATCTCGGCCTGGG + Intergenic
1195546082 X:106114205-106114227 CCTGAAGCCATTTTCCTCCCTGG + Intergenic
1196195027 X:112830617-112830639 CCAGGAGCCCTGCTCTGCCCTGG - Intronic
1197148439 X:123193578-123193600 CCTGGAGCAGTTCTCGGCTCAGG - Intronic
1200663599 Y:5991986-5992008 CCTTAAGCGGTTTTCGGCCCTGG + Intergenic
1201287539 Y:12391967-12391989 CCTGAAGCCCCTCCCAGGCCCGG - Intergenic