ID: 945493025

View in Genome Browser
Species Human (GRCh38)
Location 2:210477760-210477782
Sequence GCCCATGGTGAGTCTTAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945493021_945493025 7 Left 945493021 2:210477730-210477752 CCTCATCAAATTCATGAAGATTT 0: 1
1: 0
2: 1
3: 42
4: 412
Right 945493025 2:210477760-210477782 GCCCATGGTGAGTCTTAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945493025 Original CRISPR GCCCATGGTGAGTCTTAAGC TGG Exonic
900612426 1:3549785-3549807 GTACAAGGTGAGTCTTGAGCAGG + Intronic
903801113 1:25969027-25969049 GCCCCTGGTGAGTTCTAAGCAGG - Intronic
904007665 1:27372201-27372223 GCCCCAGGAGAGTTTTAAGCAGG - Intronic
905738020 1:40344107-40344129 GCCATTGGAGAGTTTTAAGCAGG - Intergenic
907444456 1:54499051-54499073 GCCCATGGTCAGTACCAAGCTGG - Intergenic
907700110 1:56777919-56777941 GCCTCTGGAAAGTCTTAAGCAGG - Intronic
911339263 1:96617548-96617570 GCCATTGCTGAGGCTTAAGCAGG - Intergenic
919284286 1:195533947-195533969 GCCTATGGTGAGTTTTAGGGAGG + Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
923541874 1:234893963-234893985 GCCCATGGTGAGTCAGCACCAGG + Intergenic
924520666 1:244803311-244803333 GCCCTTGGGGAGTCTGAGGCGGG + Intergenic
1068608820 10:59036055-59036077 GCCAATGGAGTGTGTTAAGCAGG + Intergenic
1070500413 10:77067278-77067300 CCTGATGGTCAGTCTTAAGCTGG + Intronic
1070723032 10:78769753-78769775 GCCCTGGATGAGTCTTGAGCAGG - Intergenic
1072893468 10:99345600-99345622 CACCATGGTGATTTTTAAGCAGG + Intronic
1075964035 10:126594933-126594955 GGCCCTGGAGAGTCTTAAGGTGG + Intronic
1076133523 10:128029418-128029440 GCCCATGGGGCGTCTGAAGCAGG + Intronic
1084583594 11:70040152-70040174 TCCCATTGTGGGTCTTGAGCAGG - Intergenic
1085113855 11:73912667-73912689 GCCACTGGAGAGTTTTAAGCAGG - Intronic
1085480660 11:76820338-76820360 GCCAATGCTGTGTCTCAAGCTGG - Intergenic
1085519665 11:77130631-77130653 GACCATGGTGATTCTTCAGCAGG + Exonic
1086940673 11:92795161-92795183 GTCAATGGTGAGTCTGAGGCAGG + Intronic
1089535036 11:119155840-119155862 GCCCATGCTGTGTCTTCTGCTGG + Intronic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1096120091 12:49083053-49083075 GCACTTTGGGAGTCTTAAGCAGG + Intergenic
1104014766 12:124954350-124954372 GCCAATGGTGAATTTTGAGCTGG - Intronic
1112429811 13:99341539-99341561 GCCCATGGTGTATTTAAAGCTGG + Intronic
1118483352 14:66189407-66189429 GCCATTGCTGAGGCTTAAGCAGG - Intergenic
1121485917 14:94314265-94314287 GCCCATGGTCATTTCTAAGCTGG + Exonic
1126599050 15:50410688-50410710 GCTCATGGTGACTCTCATGCTGG - Intergenic
1129138253 15:73573646-73573668 GCCCATGGTGAGTAGGAGGCAGG - Exonic
1129433776 15:75521144-75521166 GCCCATTGTAAATCTTAAACTGG - Intronic
1131399573 15:92113660-92113682 AACCATGGTGGGTCTGAAGCTGG + Intronic
1133821315 16:9238920-9238942 GCACATGGTGATATTTAAGCAGG - Intergenic
1134271579 16:12737522-12737544 GCCCCTGGAGGGTTTTAAGCAGG + Intronic
1140130797 16:72159077-72159099 GACCATGGTTAGTTTTCAGCAGG - Intronic
1140526460 16:75627045-75627067 GCCCATGGTGAATGCTCAGCTGG + Intergenic
1140761071 16:78109365-78109387 GCACATGTTGATTCTTCAGCTGG - Intronic
1143219955 17:5253284-5253306 GCCCAAGGTGCATCTTAATCGGG + Intergenic
1144750770 17:17646888-17646910 GCCCACGGTGGCTCTTCAGCAGG + Intergenic
1147492775 17:40886043-40886065 TCTCATGGTGGGTGTTAAGCTGG - Intergenic
1148715870 17:49715430-49715452 TGCCCTGGTGAGTATTAAGCTGG + Intronic
1149081658 17:52665566-52665588 GCCCAGGCTGGGTCTTAGGCTGG - Intergenic
1149604883 17:57917437-57917459 GCCCTTGGAGAGTCTCAACCAGG + Intronic
1150620265 17:66802949-66802971 GCCCAGGGTGACTCTGAAGCAGG - Intronic
1158147677 18:54334391-54334413 GCCATTGGTGTGTTTTAAGCAGG - Intronic
1160507862 18:79437289-79437311 GGGCAAGGTGAGTCCTAAGCAGG - Intronic
1161152359 19:2716482-2716504 GCCCATGGTGCCTCTCCAGCGGG + Exonic
1161508660 19:4658157-4658179 GCCCATGGTGGGGGCTAAGCAGG + Intronic
1161753508 19:6114682-6114704 CCCCATGGAGGGTTTTAAGCAGG + Intronic
1161931214 19:7341646-7341668 GCCCCTGGAGGGTTTTAAGCAGG - Intergenic
1163845404 19:19635628-19635650 GACCCTGGTGAGGCTGAAGCAGG - Exonic
1163914183 19:20225160-20225182 GCACATTGGGAGGCTTAAGCAGG + Intergenic
1164089683 19:21937718-21937740 GCACATTGGGAGTCTGAAGCAGG - Intronic
1167356320 19:49006455-49006477 GCCCATAGTCACTCCTAAGCAGG + Intronic
1168651662 19:58096118-58096140 GAGCCTGGGGAGTCTTAAGCAGG + Intronic
926854171 2:17234277-17234299 CCACATTGTGATTCTTAAGCAGG + Intergenic
928632409 2:33207300-33207322 GCCCATGGTTTGGCTTCAGCAGG + Intronic
929424964 2:41835092-41835114 GCCATTGGTGAGTGTTAAGAAGG + Intergenic
932088529 2:68783995-68784017 GCCCACAGTGAATCTTCAGCTGG - Intronic
933248719 2:80004483-80004505 GCCCATAGTGAGTGTTCAGCAGG - Intronic
937211082 2:120271675-120271697 GCACATGCTGTGTGTTAAGCTGG + Intronic
937714341 2:125014460-125014482 GCACATGATGAGTGATAAGCAGG - Intergenic
938138316 2:128776798-128776820 GCCCAGGGAGAGTCTTAACTAGG - Intergenic
939216555 2:139246411-139246433 TACCATGGTGATACTTAAGCTGG + Intergenic
944223703 2:197328092-197328114 GCCCATGGTGAAAAATAAGCTGG + Intergenic
944315548 2:198281840-198281862 AGCCATGGAGAGTTTTAAGCAGG - Intronic
945252762 2:207778244-207778266 GCCCAGGCTGAGTCTTGAACTGG + Intergenic
945493025 2:210477760-210477782 GCCCATGGTGAGTCTTAAGCTGG + Exonic
1170047831 20:12105433-12105455 GCCCCTGGTGAATATAAAGCAGG + Intergenic
1172197227 20:33100236-33100258 GTACATGGTGAGTGTTAACCAGG + Intronic
1177187498 21:17814153-17814175 GCCCAAAGTGAGACCTAAGCAGG - Intronic
1182366673 22:29783872-29783894 GCCCCAGCAGAGTCTTAAGCAGG + Intergenic
1183211744 22:36455400-36455422 GCCCGTCGTGAGTCTTAGCCTGG - Intergenic
1184382377 22:44153254-44153276 GCCCCTGGAGAGTCTGAAGGGGG - Intronic
955544476 3:60013418-60013440 GTCCATGGTGAGTCATCAGTAGG - Intronic
978604050 4:110459869-110459891 AGCCATGGAGAGTTTTAAGCAGG + Intronic
979322035 4:119336002-119336024 GCCAGTGGAGAGTGTTAAGCAGG + Intergenic
980975028 4:139602682-139602704 GTGCATGGTGAATCTTCAGCTGG - Intronic
983240012 4:165221611-165221633 GCCAGTGGAGAGTGTTAAGCGGG + Intronic
985843896 5:2329997-2330019 GCCCGTGGGGAGTCTGCAGCCGG + Intergenic
987904351 5:24056461-24056483 GACCATGCTGAGTCTTTTGCAGG - Intronic
988154783 5:27437059-27437081 GCCTAAGGTTATTCTTAAGCAGG + Intergenic
991052310 5:62286409-62286431 GCCCCTGGAGAGTTTTAAGCAGG + Intergenic
991134200 5:63162477-63162499 ACCCATGGTGTGGCTTAAGGAGG + Intergenic
992573786 5:78090088-78090110 GCCTTTGAAGAGTCTTAAGCAGG - Intronic
1002199286 5:177518256-177518278 TCCCATGGTGGGTCTCAACCTGG + Intergenic
1002199379 5:177518979-177519001 TCCCATGGTGGGTCTCAACCTGG + Intergenic
1003078511 6:3002628-3002650 GCCCTTGGAGCCTCTTAAGCTGG - Intronic
1012105414 6:95151266-95151288 GCCTTTGGTGAGTTCTAAGCAGG - Intergenic
1015064422 6:129006691-129006713 GCCCTAGGAGAGTATTAAGCAGG - Intronic
1015594274 6:134851296-134851318 GCCCATGGGGATTCTTAACTGGG - Intergenic
1018857318 6:167683977-167683999 GCCAATGATGGGACTTAAGCTGG - Intergenic
1019351843 7:557683-557705 GACCGTGGTGCGTCTCAAGCTGG - Intronic
1020375697 7:7483140-7483162 GCCCATTGTAAGTCATAAGGAGG - Intronic
1021265936 7:18522722-18522744 GCCCATGATATGTCTTAAGAAGG + Intronic
1026679090 7:72451641-72451663 GCCAATGGTGAACCTTAGGCAGG - Intergenic
1028188428 7:87817377-87817399 GCCATTGGAGAGTCTGAAGCAGG - Intronic
1032756614 7:134896915-134896937 ACCCAAGGTGTGTCTGAAGCTGG - Intronic
1032874971 7:136028410-136028432 GTCCCTGGAGAGTTTTAAGCAGG - Intergenic
1033138488 7:138804166-138804188 GCCCATGGGGAGTGATGAGCCGG - Exonic
1038142183 8:24858115-24858137 GCCACTGGAGAGTTTTAAGCAGG - Intergenic
1039719416 8:40146513-40146535 TCCCAGGTTGAGTCTTGAGCAGG - Intergenic
1043496778 8:80809990-80810012 GGCCATGGTGAGGATAAAGCTGG - Intronic
1044221108 8:89670696-89670718 GCCCATGGTGAGTATTGAATTGG - Intergenic
1047310402 8:123687068-123687090 GCTCATGGTGGATTTTAAGCTGG - Intronic
1047982633 8:130198842-130198864 GCCAATGATGGGTTTTAAGCAGG - Intronic
1051099041 9:13500022-13500044 GCCCAGAGTGAGTGTTAAGTGGG - Intergenic
1052242520 9:26291642-26291664 GCCCATGGTGGGTCCCAAGCAGG - Intergenic
1053564969 9:39239796-39239818 GGTCAAGGTGAGTCCTAAGCAGG + Intronic
1053830747 9:42077671-42077693 GGTCAAGGTGAGTCCTAAGCAGG + Intronic
1054132181 9:61379243-61379265 GGTCAAGGTGAGTCCTAAGCAGG - Intergenic
1054599811 9:67109766-67109788 GGTCAAGGTGAGTCCTAAGCAGG - Intergenic
1186512658 X:10142190-10142212 GCTCAGCGTGAGTCTGAAGCAGG + Exonic
1190939446 X:55026476-55026498 GCCCAGGGTGTTTCCTAAGCAGG + Intronic
1193369548 X:80678033-80678055 GCCAGTGGAGAGTTTTAAGCTGG + Intronic
1195394225 X:104393763-104393785 GCCATTGGTGGGTTTTAAGCAGG + Intergenic
1197778919 X:130140273-130140295 GCACAGGGTGAGGGTTAAGCAGG + Intronic
1199911823 X:152295382-152295404 GCCATTGGTGAGGCTTGAGCAGG - Intronic
1200232041 X:154448970-154448992 GCCCATGGTGAGCAGGAAGCAGG - Intronic
1201772929 Y:17635186-17635208 GCCCCTGGGGAGTCTGAGGCAGG - Intergenic
1201828626 Y:18270800-18270822 GCCCCTGGGGAGTCTGAGGCAGG + Intergenic