ID: 945493235

View in Genome Browser
Species Human (GRCh38)
Location 2:210480100-210480122
Sequence TGTGATCCTGAATGGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945493235 Original CRISPR TGTGATCCTGAATGGCCACA TGG (reversed) Intronic
903349434 1:22709438-22709460 TGTCATCCTGGAAGGCCACCAGG - Intergenic
906091463 1:43183055-43183077 TGTGGTGCTGTGTGGCCACATGG + Intronic
906896525 1:49779254-49779276 TGTGATCCTAAATGTCAAAATGG + Intronic
907908015 1:58801968-58801990 TGTGAGCCTCACTTGCCACAAGG + Intergenic
908845214 1:68317579-68317601 TGGGCTCCCGAATGACCACATGG - Intergenic
909763138 1:79319479-79319501 TTTGATCTTGAATGGTAACATGG + Intergenic
910384731 1:86668968-86668990 TATGTTCCTGAATGTCCACTGGG + Intergenic
910620285 1:89246013-89246035 TCTGCTCCTGAATGACTACAGGG + Intergenic
910644927 1:89504157-89504179 TGTGCTACTGAAGGGCCACTGGG + Intergenic
910906133 1:92181125-92181147 TGTAATCCTGAAAGGACAAATGG + Exonic
911212118 1:95153126-95153148 TGTGATCCTGGCTGGGCAGAAGG + Intronic
914343581 1:146779756-146779778 TATGCTCCTGATTGGACACATGG - Intergenic
915654223 1:157345650-157345672 TGTGCTCCTGAATGACCACTGGG - Intergenic
915811201 1:158913169-158913191 TATGTTCCTGAATGACCAGAGGG + Intergenic
916164611 1:161954718-161954740 TATGATTCTGAATGCCCAGAGGG - Intronic
916364862 1:164014608-164014630 TGTGATCATGAAGAGACACATGG - Intergenic
916604782 1:166330281-166330303 TGCATTCCTGAATGGTCACATGG + Intergenic
921045305 1:211472687-211472709 TGGGTCCCTGAATGACCACATGG - Intergenic
921929071 1:220739387-220739409 TATGCTCCTGAATGGCCAGTGGG - Intergenic
922610907 1:226926985-226927007 TCTGATCCTGAATGACTACTGGG + Intronic
922666803 1:227476761-227476783 TGTGCTCCTGAATGACTACTGGG + Intergenic
923520056 1:234728437-234728459 TGACATCCTGGAAGGCCACAGGG + Intergenic
924040315 1:239978242-239978264 TGGGTTCCTGGATGACCACAGGG + Intergenic
924193563 1:241580604-241580626 TATGCTCCTGAATGACCACTGGG - Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1064773515 10:18750046-18750068 TGGGACCCTGAATGGCCATGTGG - Intergenic
1065943345 10:30584671-30584693 TGTGATTCTCAATGGGCAGAGGG + Intergenic
1069356026 10:67586079-67586101 TATGCTCCTGAATGACCACTGGG - Intronic
1070269728 10:74941255-74941277 TGTTATTCTGAATAGTCACATGG + Intronic
1070788852 10:79177985-79178007 CATGATCCTTAATGGCCACATGG + Intronic
1071401505 10:85277658-85277680 TGTGCTCCTGAATGACTACTGGG - Intergenic
1071781172 10:88846751-88846773 TGGTATCCTGATTGCCCACAAGG + Intronic
1071988369 10:91075303-91075325 TGTGGTCCTGCAGGGACACAGGG - Intergenic
1072398964 10:95077472-95077494 TGTGCTCCTGAATGACCAGTGGG - Intergenic
1073127659 10:101161905-101161927 TATCACCCTGAATGGCCACAAGG + Intergenic
1074408774 10:113204991-113205013 TGTGCTCCTGAATGACCAGTGGG + Intergenic
1074430600 10:113390888-113390910 GGTGATCCTGAATTGTCCCAGGG + Intergenic
1074637822 10:115341273-115341295 TATGCTCCTGAATGACCAGAGGG - Intronic
1074798769 10:116977590-116977612 TGTGATTCTGCATGGTTACAGGG + Intronic
1075572660 10:123557105-123557127 TGTGGTCCTCACTGGCCAAATGG + Intergenic
1077428466 11:2500056-2500078 TATGCTCCTGAATGACCAGAGGG + Intronic
1077794365 11:5476389-5476411 TGTTATGCTGTATGGCCACAAGG + Intronic
1077996681 11:7458649-7458671 TGTATTTCTGCATGGCCACAGGG - Intronic
1079170537 11:18090700-18090722 TGTGATTTGGAATGGACACATGG - Intronic
1079757593 11:24284149-24284171 CCTGCTCCTGAATGGCCACTGGG + Intergenic
1080439788 11:32281751-32281773 TGAGTTCCTGAATGGCTACATGG + Intergenic
1082030287 11:47598657-47598679 TCTGATCCAGAAGGGACACATGG - Intergenic
1086767440 11:90715219-90715241 TATGATCCTGAATAGCCAATGGG - Intergenic
1086802644 11:91195933-91195955 TGTGACCATGAAGGGTCACAGGG - Intergenic
1086828518 11:91529882-91529904 TTTGATCCTGAATGACCAGTGGG + Intergenic
1087080329 11:94164457-94164479 TATGCTCCTGAATGACCACTGGG - Intronic
1088197969 11:107296574-107296596 CGTGGTCCTGAATGGCTACTGGG + Intergenic
1088780818 11:113132431-113132453 TGTGTTCCTTAATGCCCCCAAGG + Intronic
1089049331 11:115532959-115532981 TTTGTCCCTGAATTGCCACATGG - Intergenic
1091310404 11:134571350-134571372 TGGGACCCTGAAGGGCAACAAGG - Intergenic
1092493081 12:8964294-8964316 TCTGCTCCTGAATGGCTACTGGG - Intronic
1092656587 12:10691363-10691385 TGTCAACTTGACTGGCCACAGGG - Intergenic
1095065302 12:37764575-37764597 CCTGATCCTGAATGACTACAGGG + Intergenic
1097651195 12:62298982-62299004 TGTGATTCTTAATGGGTACAAGG - Intronic
1097917211 12:65033711-65033733 TCTGATCCTGAATGACTACTGGG - Intergenic
1098504194 12:71230166-71230188 TATGCTCCTGAATGACCAAAGGG + Intronic
1099601510 12:84745325-84745347 TGATAGCCTGAAGGGCCACATGG - Intergenic
1099882507 12:88483801-88483823 TGTGCTCCTGAATGACCAGTGGG + Intergenic
1103971213 12:124674038-124674060 TCTGGTCCTGAATGACCTCAAGG + Intergenic
1104221635 12:126790154-126790176 TGTCAGCCTCACTGGCCACAGGG - Intergenic
1105691276 13:22841903-22841925 TGTGATCCATACTGGTCACATGG - Intergenic
1105783461 13:23724459-23724481 TGTCAGCATGACTGGCCACAGGG - Intergenic
1107774955 13:43829265-43829287 TGTGATAATGAATGGCTAAAAGG + Intronic
1107874150 13:44774758-44774780 CGTGCTCCTGAATGACCACTGGG - Intergenic
1110388766 13:74946504-74946526 TATGATCCTGAATGACCAGTGGG + Intergenic
1113558930 13:111261852-111261874 TGTGCTCCTGAATGACCAGTGGG + Intronic
1115963971 14:38865930-38865952 TGAGTTCCTGAACGACCACAAGG + Intergenic
1116273087 14:42797518-42797540 TCTGCTCCTGAATGGCTACTAGG - Intergenic
1116276740 14:42843715-42843737 TATGATCCTGAATGACCAGTAGG - Intergenic
1116861231 14:49997322-49997344 TGTCAACCTGACTGGCCACAGGG + Intronic
1117466226 14:55997309-55997331 CCTGCTCCTGAATGGCCACTGGG - Intergenic
1118538722 14:66799070-66799092 TATGCTCCTGAATGACCACTGGG - Intronic
1119015031 14:71041932-71041954 TGTGCTCCTGAATGAACACTGGG - Intronic
1119072548 14:71602314-71602336 TATGCTCCTGAATGACCACTGGG - Intronic
1120439408 14:84517273-84517295 TATGCTCCTGAATGACCAGAGGG - Intergenic
1120559387 14:85972297-85972319 TGTGCTCCTGAATGACTACAGGG - Intergenic
1121341781 14:93109719-93109741 TGTGATGCTGAAAGGCCACCAGG + Intronic
1124128627 15:26964565-26964587 TGTGATCCTGAATGGGTTCCTGG + Intergenic
1126944025 15:53797956-53797978 TATGCACCTGAATGGCCACTGGG + Intergenic
1126953034 15:53903512-53903534 TGTGGAACTGGATGGCCACAAGG + Intergenic
1129070847 15:72949795-72949817 CATGCTCCTGAATGACCACAGGG + Intergenic
1129922759 15:79334340-79334362 TTTGGTCCTGAATGGCCAAATGG + Intronic
1131871646 15:96770182-96770204 TTGGAGCCTGAATGGCCAAAGGG + Intergenic
1133629192 16:7602971-7602993 TGTGCTCCTGAATGTCCATTGGG + Intronic
1137486500 16:48895708-48895730 TTGGAACATGAATGGCCACAAGG + Intergenic
1137826504 16:51501186-51501208 TGGGCCCCTGAATGACCACATGG + Intergenic
1137969712 16:52972821-52972843 TCTGCTCCTGAATGGCTACTGGG - Intergenic
1138796858 16:59979340-59979362 TCTGCTCCTGAATGACTACAGGG + Intergenic
1139990410 16:70935578-70935600 TATGCTCCTGATTGGACACATGG + Intronic
1141649833 16:85386968-85386990 TGTGATGCTGCGTGGCCCCAGGG - Intergenic
1141844946 16:86601937-86601959 TGTGACCCTGAATGGCTCTAAGG - Intergenic
1142973841 17:3631285-3631307 GGTGATCCTGCATAGCCACCTGG - Intronic
1144040217 17:11403896-11403918 TGTGTTCCTGAGTGGCCCCATGG - Intronic
1148872584 17:50667598-50667620 TGAGATCCTGAACGGCATCAAGG + Exonic
1150020445 17:61607169-61607191 TGAGATGATGAATGGCCTCATGG + Intergenic
1150825122 17:68467597-68467619 TGTGACCCAGAATGAGCACAGGG - Intergenic
1152033045 17:77855480-77855502 TGTGATGCTGAAAGTCCACAGGG - Intergenic
1154507037 18:15051899-15051921 TGGGTTCCTGAATGACCACATGG - Intergenic
1155819619 18:30358859-30358881 TGTCTTCCTGAATAGCCACATGG - Intergenic
1157191322 18:45584473-45584495 TCTGTTGCTGAATTGCCACATGG - Intronic
1157886660 18:51374024-51374046 TATGCTCCTGAATGACCACTGGG + Intergenic
1158421564 18:57299493-57299515 TGGGACCCTGAATGACTACATGG - Intergenic
1158860242 18:61584479-61584501 TGTGATCCTGATTGGTCTAAGGG + Intergenic
1158948751 18:62472135-62472157 TATGCTCCTGAATGACCACTGGG - Intergenic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1166639091 19:44479298-44479320 TGTGATCCTGGAGAACCACAGGG - Exonic
925159554 2:1674523-1674545 TGTGATGCAGCATGGCCCCAGGG - Intronic
928459717 2:31459212-31459234 TGTGCTCCTGAATGACCAGTGGG + Intergenic
929528052 2:42724716-42724738 TGGGATCCAGAATGACCACAGGG - Intronic
930003553 2:46878932-46878954 TGTGACCCTCAAAGGCCACAAGG + Intergenic
930895137 2:56437072-56437094 TATGATCCTGAATGACCAGTGGG - Intergenic
931246135 2:60494227-60494249 GGTGATGCTGACAGGCCACATGG + Intronic
933269024 2:80213472-80213494 TGTGCTCCTGAATGACTACTGGG - Intronic
935583346 2:104778936-104778958 TGGGTTCCTGAATGACCACATGG - Intergenic
937449089 2:121986137-121986159 TGTGCTCCTCAATGGCCAGTTGG + Intergenic
937502478 2:122494866-122494888 TTTGCTCCTGAATGGCTACTGGG + Intergenic
939427583 2:142059158-142059180 AGTGATTGTGAATGGGCACAAGG + Intronic
939483128 2:142774594-142774616 TATGCTCCTGAATGGCCAGTGGG - Intergenic
939929202 2:148211644-148211666 TGTGACTTTGAATAGCCACATGG - Intronic
940190231 2:151032909-151032931 TGAGTCCCTGAATTGCCACATGG + Intronic
941861798 2:170289951-170289973 TGTGTTCCTGAATGACCAATGGG - Intronic
942964811 2:181879051-181879073 AGTGATACTGAATGGGCAGAAGG - Intergenic
943281473 2:185939839-185939861 TGTGTTCCTGAATGACCATTGGG - Intergenic
945493235 2:210480100-210480122 TGTGATCCTGAATGGCCACATGG - Intronic
946877754 2:224146939-224146961 TGTGATCCTGGAAGGCCAATGGG + Intergenic
947529012 2:230896796-230896818 TGTGATCCTGACTGGCCAGTCGG + Intergenic
1169624175 20:7544040-7544062 TATGATCCTGAATGACCAGTGGG + Intergenic
1170268560 20:14498492-14498514 AGGGATCATGATTGGCCACAGGG - Intronic
1173942837 20:46926661-46926683 TGTCAGCTTGATTGGCCACAGGG - Intronic
1174757644 20:53175484-53175506 TCTGATGCTCAATGGCCAGAAGG + Intronic
1174995159 20:55558705-55558727 TATGATTATGAATGGCTACATGG + Intergenic
1175793905 20:61759381-61759403 TGTGAGACTGAAACGCCACATGG + Intronic
1175810004 20:61852768-61852790 TGTGGACATGAATGGCAACAAGG + Exonic
1176350289 21:5788698-5788720 TGAGTTTCTGAATGACCACATGG - Intergenic
1176357103 21:5909282-5909304 TGAGTTTCTGAATGACCACATGG - Intergenic
1176544610 21:8186768-8186790 TGAGTTTCTGAATGACCACATGG - Intergenic
1176563561 21:8369813-8369835 TGAGTTTCTGAATGACCACATGG - Intergenic
1176790837 21:13317198-13317220 TGGGTTCCTGAATGACCACATGG + Intergenic
1177990954 21:28036170-28036192 TGGGTTCCTGAATGACCACATGG - Intergenic
1178633775 21:34284756-34284778 TGTCAACTTGACTGGCCACAGGG + Intergenic
1179019655 21:37626955-37626977 TGCTCTCCTGAATGGACACAGGG - Intronic
1179064299 21:38009795-38009817 TGTGATCCAAAATGGCCTGAGGG + Intronic
1179431901 21:41327067-41327089 TGGGAGGCTGAAGGGCCACAGGG - Intronic
1180575415 22:16768841-16768863 TGTGCTCCTGAATGACTACTGGG + Intergenic
1180961031 22:19762418-19762440 TGTTGTCCTGAAGGGCCCCACGG + Intronic
1182201610 22:28577227-28577249 TGTGTTCCTGAATGACCAGTGGG - Intronic
1182824336 22:33251237-33251259 TGAGCTCCAGAATGGACACATGG - Intronic
1183975182 22:41507899-41507921 TCGCATCCTGCATGGCCACACGG - Exonic
1203249479 22_KI270733v1_random:103005-103027 TGAGTTTCTGAATGACCACATGG - Intergenic
949155283 3:819371-819393 TGTGCTCCTGAATGACTACTGGG + Intergenic
951832476 3:26945736-26945758 TGTGCTCCTGAATGACTACTGGG + Intergenic
952532547 3:34277156-34277178 TGTGTTCCTGAATGACTGCATGG - Intergenic
952570478 3:34710125-34710147 TGTGATCCTGAGTGGCAAAAAGG - Intergenic
959042149 3:101434165-101434187 TATGTTCCTGAATGGCCAATGGG + Intronic
959639784 3:108619777-108619799 TGTCAACTTGACTGGCCACAGGG - Intronic
960357927 3:116676660-116676682 TGTGGTCCTGAGCAGCCACAAGG + Intronic
961915614 3:130370909-130370931 TGTGGGCATGAATGGCCACCTGG + Intronic
963170548 3:142246434-142246456 TATGTTCCTGAATGACCAGAGGG + Intergenic
964179909 3:153870728-153870750 TTTGCTCCTGAATGGCCAGTGGG + Intergenic
965156118 3:165058171-165058193 TATGCTCCTGAATGACCACTGGG + Intronic
965720890 3:171661095-171661117 TGGTATCCTGAATGGCATCATGG - Intronic
968561621 4:1286172-1286194 TGTGATCCTGAAGCCCCAGAGGG + Intergenic
969038085 4:4272205-4272227 TGTTATCCTGGGTGGCAACAAGG + Intronic
974469934 4:62305647-62305669 TATGCTCCTGAATGACCAGAGGG + Intergenic
975202036 4:71602557-71602579 TTTGTTCCTGACTGGCCACAGGG + Intergenic
976450784 4:85188489-85188511 TATGTTCCTGAATGACCACTCGG - Intergenic
976857528 4:89622553-89622575 TGGGAGACTGAATGGACACAGGG + Intergenic
977106653 4:92894381-92894403 TGTTATCTTGAATGGCCAGGAGG + Intronic
977635757 4:99296199-99296221 TCTGCTCCTGAATGGTCACTGGG + Intergenic
977863713 4:101998175-101998197 TGTGCTCCTGAATGACTACTGGG - Intronic
978661680 4:111134904-111134926 TGTGTTCCTGAATGACCAGTGGG - Intergenic
980195006 4:129577520-129577542 TGTGCTCCTGAATGATCACTGGG - Intergenic
982537394 4:156623901-156623923 TGTGATTCTTACTGGCTACAAGG + Intergenic
983463549 4:168057211-168057233 TGTGACCCTGAATGTACAAAAGG + Intergenic
983514528 4:168642147-168642169 TGTGATCCTGAAAGACCCGAGGG - Intronic
985131648 4:186744640-186744662 TGTGCTCCTGAATGTCCTGAAGG - Intergenic
986585246 5:9309602-9309624 TGGGATCCTGAACGGCAGCATGG + Intronic
987527924 5:19077914-19077936 TCTGCTCCTGAATGACTACAGGG - Intergenic
987889392 5:23856606-23856628 TGTGCTCCTGAATGACTACTGGG - Intergenic
987911925 5:24158157-24158179 TATGATCCTGAATGGACAGTGGG + Intronic
988381029 5:30497083-30497105 CCTGATCCTGAATGACTACAGGG - Intergenic
991535353 5:67664078-67664100 AGTGCTCCTGAATGACCACTGGG - Intergenic
992824298 5:80532882-80532904 TATGCTCCTGAATGGCCAGTGGG + Intronic
992840467 5:80685905-80685927 TATGCTCCTGAATGGCCAGTGGG - Intronic
993088374 5:83392919-83392941 TGTCAACCTGATTGGCCAGAAGG - Intergenic
993267323 5:85742793-85742815 TATGCTCCTGAATGACCACTGGG - Intergenic
994533881 5:101002915-101002937 TATGTTCCTGAATGACCACTGGG + Intergenic
995777698 5:115742780-115742802 TGTGCTCCTGAATGACCAGTGGG - Intergenic
996411471 5:123163842-123163864 TGTGAACCTTGATGGCAACAGGG + Intronic
996662504 5:126020956-126020978 TGTCATAGTGAATGGCCTCAGGG + Intergenic
996906180 5:128603339-128603361 TATGCTCCTGAATGGCCAGTGGG - Intronic
997217566 5:132126685-132126707 TGTGCTCCTGAATGACTACTGGG - Intergenic
998008534 5:138674293-138674315 TTAGATACTGAATTGCCACATGG + Intronic
998780740 5:145653632-145653654 TCTGCTCCTGAATGACCACTGGG + Intronic
998803440 5:145894016-145894038 TCTGCTCCTGAATGACCACTGGG + Intergenic
1000392231 5:160735876-160735898 TGTGCTCCTGAATGACCAGTGGG + Intronic
1001052000 5:168421119-168421141 TGAGTTCCTGAATGACCACATGG - Intronic
1002402779 5:179001098-179001120 TGAGATCCTGAATTGTCACGTGG + Intergenic
1003432762 6:6055168-6055190 TCAGCTCCTGAAGGGCCACATGG - Intergenic
1005785576 6:29242237-29242259 TGTGCTCCTGAATGACTACTGGG - Intergenic
1005836196 6:29711312-29711334 TGTGAACCAGAATGCCCACTAGG + Intergenic
1007266333 6:40599117-40599139 TGTGAGCATGAAAGGCCAGATGG + Intergenic
1008994179 6:57639136-57639158 TCTGCTCCTGAATGACTACAGGG + Intronic
1009717897 6:67424542-67424564 TGTCATACTGAATGGGCAAAAGG - Intergenic
1009783768 6:68303871-68303893 TATGTTCCTGAATGACCACTGGG + Intergenic
1011280678 6:85674115-85674137 CCTAATCCTGAAAGGCCACAGGG + Intergenic
1011297057 6:85837752-85837774 TGTGCTCCTGAATGACCACTGGG + Intergenic
1012017300 6:93869015-93869037 TCTGCTCCTGAATGACTACAGGG - Intergenic
1014172650 6:118296028-118296050 TGGGTTCCTGAATGGCTGCATGG - Intronic
1014557957 6:122856042-122856064 TGTGATTCTGTTTGGCCTCAAGG - Intergenic
1014928715 6:127307054-127307076 TATGCTCCTGAATGGCCAATGGG + Intronic
1015466418 6:133553223-133553245 TCTGATCCTCAGTGGCCACAGGG - Intergenic
1017261350 6:152391402-152391424 CGTGCTCCTGAAGGGCCACCTGG + Exonic
1017729968 6:157306420-157306442 TGTGGTCAGGAATGGCCACCTGG + Intronic
1018760224 6:166887703-166887725 CGTGCTCCTGAATGACCACTGGG + Intronic
1019623932 7:2006200-2006222 TGTGTCCTTGAATGGCCACAGGG - Intronic
1020457575 7:8391443-8391465 TGTTATCCTGCATGGCAAAAGGG + Intergenic
1021035204 7:15789504-15789526 TATGCTCCTGAATGACCACTGGG + Intergenic
1021755527 7:23847726-23847748 TGTGCTCCTGAATGACTACTGGG + Intergenic
1022862300 7:34380204-34380226 GAAGATCCTGGATGGCCACATGG - Intergenic
1023116991 7:36872360-36872382 TGTGTTCCTGAATGACTATATGG + Intronic
1024249561 7:47495995-47496017 TGTGATCCAGAAGGAGCACACGG + Intronic
1025018295 7:55460128-55460150 TATGCTCCTGAATGACCACTGGG - Intronic
1028491559 7:91417991-91418013 TGTGATGCTGAGTGGCGACTTGG + Intergenic
1030370190 7:108691024-108691046 TATGTTCCTGAATGACCACTGGG - Intergenic
1030743423 7:113137049-113137071 TGTGATCCTCCCAGGCCACAAGG + Intergenic
1031553237 7:123141166-123141188 TATGCTCCTGAATGACCACTGGG - Intronic
1031606258 7:123771681-123771703 TGTGAACTTCACTGGCCACAGGG + Intergenic
1031981240 7:128126902-128126924 TGTGATCCTGAAAGTCGACATGG - Intergenic
1033713599 7:143975869-143975891 TATAATGCTGAGTGGCCACATGG - Intergenic
1033781701 7:144678253-144678275 TGTCATACTGAATGGCACCAGGG + Intronic
1035084253 7:156243793-156243815 TATGCTCCTGAATGACCACTGGG - Intergenic
1038860447 8:31382237-31382259 TGTGTTCCTGCATGCTCACAAGG - Intergenic
1038860552 8:31383885-31383907 TGTGCTCCTGAATGACCAGTGGG + Intergenic
1039100496 8:33936650-33936672 TGTGATCCTCTCTGCCCACATGG - Intergenic
1040839738 8:51772366-51772388 TTGGATCCTGAAAGTCCACAAGG - Intronic
1041027491 8:53702214-53702236 TATGCTCCTGAATGACCAAAGGG - Intergenic
1043067384 8:75592334-75592356 TGTGATACTGAATGGGCAAAAGG - Intergenic
1043627248 8:82276843-82276865 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1043706819 8:83360587-83360609 TGTCATTTTGAATGGCCACAGGG + Intergenic
1044029244 8:87214095-87214117 TGGGATCCTGCAAAGCCACAGGG - Intronic
1044878237 8:96694657-96694679 TGTGCTCCTGAATGACCAGTGGG + Intronic
1047352126 8:124085478-124085500 TATGCTCCTGAATGGCCAGTGGG - Intronic
1048840519 8:138561959-138561981 TGTGATCATGGAAGGACACAGGG + Intergenic
1049256373 8:141616051-141616073 TGGGTTCCTGGATGACCACAGGG + Intergenic
1049407035 8:142456167-142456189 TGAGATCTGGAATGGGCACAGGG - Intronic
1049996628 9:1041335-1041357 TTTGTTCCTCACTGGCCACAAGG + Intergenic
1050981540 9:12022201-12022223 AATGATCATGAATGGCTACATGG + Intergenic
1051270157 9:15347734-15347756 TGTCAACTTGATTGGCCACAGGG + Intergenic
1052204613 9:25824412-25824434 TGTGCTCCTGAATGACCAGTGGG - Intergenic
1052667734 9:31516634-31516656 TGTGCTCCTGAATGGCTACTGGG - Intergenic
1054334296 9:63789933-63789955 TCTGCTCCTGAATGGCTACTGGG + Intergenic
1055309865 9:74967453-74967475 TATGTTCCTGAATGACCACTGGG + Intergenic
1055445085 9:76374535-76374557 TGTGTTGTTGATTGGCCACAGGG + Intergenic
1055691045 9:78831080-78831102 TGTGATTCTGGCTGGGCACAGGG - Intergenic
1056556280 9:87691737-87691759 CATGCTCCTGAATGACCACAGGG - Intronic
1059258690 9:112954995-112955017 TGGGTTCCTGAATGACTACAAGG + Intergenic
1061058165 9:128235588-128235610 TGTGATTCACAATGGCCAAAAGG - Intronic
1061599140 9:131655143-131655165 TCTGATCCTGCCTGGCCACCTGG - Intronic
1203465872 Un_GL000220v1:86266-86288 TGAGTTTCTGAATGACCACATGG - Intergenic
1186159343 X:6760370-6760392 TGTGATCCTGCCTTGCCAAAGGG - Intergenic
1187083845 X:16021380-16021402 TGGGTTCCTAAATGACCACAAGG - Intergenic
1187133178 X:16522274-16522296 TGTGCTCCAGAATGGCCAGTGGG + Intergenic
1187286288 X:17906956-17906978 TGTGCCCCTGAATGACCAAATGG + Intergenic
1188814175 X:34690853-34690875 TGTGCTCCTGAATGACCAGTGGG - Intergenic
1189097629 X:38157031-38157053 TGTAATCAGAAATGGCCACATGG + Intronic
1190587216 X:51958307-51958329 TGTGCTCCTGAATGACCAGTGGG - Intergenic
1190893597 X:54593855-54593877 TATGCTCCTGAATGACCACTGGG - Intergenic
1191814956 X:65233483-65233505 TGTGCTCCTGAATGACCATTGGG + Intergenic
1191924325 X:66293204-66293226 TGTGCTCCTGAATGACCAGAGGG - Intergenic
1192116470 X:68416491-68416513 TGTGTTTCTGAATGCCCACTGGG + Intronic
1192521567 X:71805888-71805910 TATGCTCCTGAATGGCCAATGGG + Intergenic
1192718861 X:73670768-73670790 TGTGCTCCTGAAAGACCACTAGG - Intronic
1192940460 X:75906006-75906028 TATGATCCTGAATGACCAGTGGG - Intergenic
1193089313 X:77477293-77477315 TATGCTCCTGAATGGCCAATGGG + Intergenic
1193816024 X:86106108-86106130 TGTACTCCTGAATGGCCAGTGGG + Intergenic
1194096197 X:89641859-89641881 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1194189418 X:90816379-90816401 TGTGGTGGTGGATGGCCACAAGG + Intergenic
1194546641 X:95243057-95243079 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1194788820 X:98119640-98119662 TGTGCTCCTGAATGACCAGTGGG + Intergenic
1195847701 X:109246261-109246283 TGTGCTCCTGAATGACTACTGGG - Intergenic
1196538676 X:116879487-116879509 TATGCTCCTGAATGGCCAGTGGG - Intergenic
1196626329 X:117881019-117881041 TGTGCTCCTGAATGACCAGTGGG + Intergenic
1196811852 X:119635171-119635193 TGGTATCATGAATGGCAACAGGG + Intronic
1197302693 X:124800858-124800880 TGTGCTCCTGAATGACTACTGGG - Intronic
1197385807 X:125799673-125799695 TGTAATTCTGGATGTCCACAGGG - Intergenic
1197559168 X:127996038-127996060 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1198938641 X:141928293-141928315 TATGTTCCTGAATGGCCAGAAGG - Intergenic
1199037304 X:143066955-143066977 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1199136371 X:144258226-144258248 CATGTTCCTGAATGGCCACCAGG + Intergenic
1199303636 X:146241554-146241576 TGTGTACCTGAATGTCCCCACGG + Intergenic
1199456977 X:148040164-148040186 TATGAACCTGAATGGCCAGTGGG - Intergenic
1199788209 X:151124894-151124916 TATGCTCCTGAATGACCACTGGG + Intergenic
1200449203 Y:3303240-3303262 TATGCTCCTGAATGGCCAGTGGG + Intergenic
1200535994 Y:4398272-4398294 TGTGGTGGTGGATGGCCACAAGG + Intergenic