ID: 945495966

View in Genome Browser
Species Human (GRCh38)
Location 2:210507176-210507198
Sequence CTCTCGGCAGAAACTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 7, 2: 23, 3: 38, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945495964_945495966 -2 Left 945495964 2:210507155-210507177 CCTATCAGACTAACAATGGATCT 0: 20
1: 1156
2: 3412
3: 4262
4: 2567
Right 945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG 0: 1
1: 7
2: 23
3: 38
4: 141
945495961_945495966 12 Left 945495961 2:210507141-210507163 CCCATAAAGGGAAGCCTATCAGA 0: 5
1: 231
2: 5483
3: 4973
4: 2355
Right 945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG 0: 1
1: 7
2: 23
3: 38
4: 141
945495962_945495966 11 Left 945495962 2:210507142-210507164 CCATAAAGGGAAGCCTATCAGAC 0: 2
1: 174
2: 6180
3: 2792
4: 897
Right 945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG 0: 1
1: 7
2: 23
3: 38
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945495966 Original CRISPR CTCTCGGCAGAAACTCTAGA AGG Intronic
902966099 1:20004032-20004054 CTCTCAGCAGAAACTCTACAAGG + Intergenic
906200647 1:43958085-43958107 CTCTCGGCAGATCTTCTTGAGGG - Exonic
908330316 1:63064490-63064512 CCCAAGGCAGAAACTCTGGAGGG - Intergenic
908937495 1:69393780-69393802 CTCTCAGCAGAAACTCTACAAGG - Intergenic
910619172 1:89234582-89234604 CTCTCAGCAGAAACCTTACAAGG - Intergenic
915992073 1:160528290-160528312 CTCTTGGCAGAAACCCTACAAGG - Intergenic
916638485 1:166700183-166700205 CTCTAGGCAGAAAGTAGAGAAGG - Intergenic
917356244 1:174129812-174129834 CTCTCAGCAGAAACTCTACAAGG - Intergenic
917827565 1:178839311-178839333 CTCTCTGCAGAAACTCTACAAGG + Intronic
918002374 1:180509446-180509468 CTCTCTGCAGTAACTCTTGCTGG + Intergenic
918537349 1:185588192-185588214 CTCTCAGCAGAAACCCTACATGG + Intergenic
918945470 1:191059039-191059061 CTCTCTGCAGCAACTGTAAATGG + Intergenic
919266475 1:195273746-195273768 CTCTTGGAATAATCTCTAGAAGG - Intergenic
920890622 1:209981807-209981829 CTCTCGGCAGAAACTTTACAAGG - Intronic
923102960 1:230831690-230831712 CTCTCACCAGAGACGCTAGAAGG - Intergenic
923875343 1:238041458-238041480 CTCTTGGCAGAAACTCTACAAGG - Intergenic
1063072117 10:2677150-2677172 CCCACGGCAGAAACTTAAGAAGG + Intergenic
1064492701 10:15876859-15876881 CTCTCAGCAGAAACCCTACAAGG - Intergenic
1066450161 10:35521471-35521493 CTCTGGGCAGAAACTAAAGGAGG + Intronic
1066584012 10:36912387-36912409 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1073345158 10:102777318-102777340 CTCACAGCAGAAGCCCTAGAGGG + Intronic
1074016562 10:109540923-109540945 CTGTCAGCAGAAACCCTACAAGG - Intergenic
1074044532 10:109825278-109825300 ATCTGGGCAGAAATTCTAGTTGG + Intergenic
1076185328 10:128442179-128442201 CTCTTAGCAGAAACCCTACAAGG + Intergenic
1076348908 10:129801326-129801348 CTCTCTGCAGAAACTGTAAGCGG + Intergenic
1077206009 11:1344766-1344788 CTCAAGGCAGAAACTGTGGATGG + Intergenic
1078033871 11:7782130-7782152 CTCTCAGCAGAAACCTTATAAGG + Intergenic
1079577651 11:22022909-22022931 CTCTTAGCAGAAACTCTACAAGG - Intergenic
1080252909 11:30255792-30255814 CTCACTGCAGATAATCTAGAAGG + Intergenic
1080334718 11:31182377-31182399 CTCTCTGCAGAAACCCTACCAGG + Intronic
1082947745 11:58777696-58777718 TTTTCAGCAGAAACTCTAAAAGG + Intergenic
1087309889 11:96529137-96529159 CTCTTAGCAGAAACTCTACAAGG + Intergenic
1087929797 11:103964029-103964051 CACTAGGGAGAAGCTCTAGAAGG - Intronic
1090103609 11:123828534-123828556 CTCTTGGCAGAAACACTACAAGG - Intergenic
1094732815 12:33198209-33198231 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1094810718 12:34135115-34135137 CTGTCTGCAGAAAATCTACAAGG + Intergenic
1094858556 12:34432785-34432807 CCCTCGGCAGAAACTCTACAAGG + Intergenic
1095269105 12:40195469-40195491 ATCTCAGTAGAATCTCTAGAGGG + Intergenic
1095665338 12:44790275-44790297 TTCTCAGCAGAAACTCTACAAGG + Intronic
1096029726 12:48402588-48402610 CTCTCAGCAGAAACCCGACAAGG - Intergenic
1098733535 12:74067714-74067736 CTCTCAGCAGAAACTTTGCAAGG + Intergenic
1098750972 12:74292920-74292942 CACTCGGCAGAGACCCCAGAAGG - Intergenic
1099511868 12:83548715-83548737 CTCTCAGCAGAAACACTACAAGG - Intergenic
1099825727 12:87775025-87775047 CTTTCAGCAGAAACCCTAAAAGG + Intergenic
1100782691 12:98046360-98046382 ATCTCGGCAGAAAAGGTAGATGG + Intergenic
1105072896 12:133246722-133246744 ATCTCAGCAGAAACTCTACAAGG + Intergenic
1105945770 13:25188202-25188224 TTCTCTACAGAAATTCTAGAAGG + Intergenic
1108479876 13:50857712-50857734 CTCTCAGCAGAAACCCTACAAGG + Intergenic
1108526123 13:51287496-51287518 CTCTCAGCAGAAAGCCTAGAGGG + Intergenic
1109188097 13:59293494-59293516 CACTCTGCGGAAACTCTACAAGG + Intergenic
1109325951 13:60868359-60868381 TTCTCAGCAGAAACCCTACATGG - Intergenic
1109629342 13:65024170-65024192 CTTTCAGCAGAAACTCTACAAGG - Intergenic
1109648030 13:65285874-65285896 AGGTCCGCAGAAACTCTAGAAGG + Intergenic
1109941098 13:69366734-69366756 TCTTCAGCAGAAACTCTAGAAGG + Intergenic
1110199536 13:72832607-72832629 CTCTCTGCAGAAACCCTACAAGG - Intronic
1110946195 13:81421755-81421777 TTCTCAGCAGAAACCTTAGAAGG - Intergenic
1111336893 13:86836881-86836903 TTCTCGGGAGAAACTCAAGCTGG - Intergenic
1116792340 14:49352901-49352923 CTCCCTGCAGAAACCCTACAAGG - Intergenic
1116792895 14:49358376-49358398 CTCTCTGCAGAAACCCTACAAGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117859555 14:60075248-60075270 CTGTCTGCAGAAACCCTACAAGG + Intergenic
1119100628 14:71877018-71877040 CTCTTGGCAGAAACTCTACAAGG - Intergenic
1121759518 14:96433012-96433034 CTCTCGGCAGAAACTCTACAAGG - Intronic
1128492435 15:68162434-68162456 TTCTCCGGAGAAACTCTAGGAGG + Intronic
1128721327 15:69952002-69952024 CTCTAGGAAGGAACACTAGAGGG + Intergenic
1129568797 15:76655710-76655732 CTTTCAGCAGAAACACTATAAGG + Intronic
1130003202 15:80066053-80066075 CACTTGGCAGAATGTCTAGATGG - Intronic
1131732535 15:95296957-95296979 ATCTTGGCAGAGACTTTAGAGGG - Intergenic
1141897064 16:86964931-86964953 GTCTCTGCAGAGACGCTAGAGGG - Intergenic
1143649639 17:8255587-8255609 CTCAGGGGAGAAACTCTGGATGG - Exonic
1145103037 17:20092671-20092693 CTCTCGACAAAAACTGTTGATGG - Intronic
1146758859 17:35458103-35458125 CTCTCAACAGAAACCCTACAAGG - Intergenic
1156195247 18:34767609-34767631 CTCTCTGCAGAGTCTCAAGATGG + Intronic
1157066359 18:44355533-44355555 CTCTCAGCAGAAACCTTACAAGG - Intergenic
1158089205 18:53690938-53690960 CTCTGGTCAGAAACACTGGATGG + Intergenic
1159155798 18:64579934-64579956 CTCTCAGAAGAAACCCTATAAGG + Intergenic
1161883320 19:6973039-6973061 CGCTCTGCAGAAACTGGAGATGG - Intergenic
928221775 2:29409325-29409347 CTCTCTGCAGAGACAGTAGAAGG - Intronic
928464680 2:31512905-31512927 GGCTGGTCAGAAACTCTAGAAGG - Intergenic
929581490 2:43084246-43084268 CTCTTGGCAGAAACCAGAGAAGG - Intergenic
929991995 2:46798066-46798088 CTCTCCACAGAAACTCTATTGGG + Intergenic
930985938 2:57588070-57588092 CTCTCAGCAGAAACTCTACAAGG + Intergenic
933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG + Intergenic
933618481 2:84509917-84509939 CTCTCAGCAGAAACTCTACAAGG - Intergenic
934522177 2:95026388-95026410 CCCTCGCCAGAAACTTTAAAAGG - Intronic
935540287 2:104340290-104340312 CTCCCCGCAGAAACTCTCAATGG - Intergenic
936391089 2:112074404-112074426 CTCTCCACAGAAACCCTACAAGG - Intronic
936408366 2:112229504-112229526 GTGTTGGCAGAAACTCAAGAGGG - Intronic
939398542 2:141661980-141662002 CTCTCAGCAGAAACCCTACAAGG + Intronic
941048278 2:160701390-160701412 CTCTTCACAGAAAGTCTAGATGG - Intergenic
942732778 2:179077697-179077719 CTCTCTGCAGAAACTCTACAAGG + Intergenic
943130149 2:183843676-183843698 CTCTCTGCAGAAACCCTCCATGG + Intergenic
943199246 2:184798079-184798101 TTCTCAGCAGAAACCCTACAAGG - Intronic
944180658 2:196889263-196889285 CTCTCAGCCTAAAATCTAGATGG - Intronic
944361359 2:198861104-198861126 CTCTAGGAAGAAACTTTAGGAGG + Intergenic
945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG + Intronic
948041164 2:234902647-234902669 CTCAGGGCAGAAAATCAAGAGGG - Intergenic
948609176 2:239155900-239155922 CTCTGGGCAGAGCCTCTGGAAGG + Intronic
1169960157 20:11151125-11151147 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1172319447 20:33984803-33984825 ATGTCGGCATAAACTCTAGCAGG + Intergenic
1174543071 20:51304849-51304871 CTCTCAGGAGAAAATCCAGATGG - Intergenic
1177008488 21:15702885-15702907 CTCTCTGCAGAATCCCAAGATGG - Intergenic
1183048198 22:35239088-35239110 TTTTCAGCAGAAACTCTACAAGG - Intergenic
1183568305 22:38632617-38632639 CTCTCTGCACAAACCCTAGGGGG - Intronic
950419558 3:12890695-12890717 CTCTCTGCCAATACTCTAGAGGG - Intergenic
950673368 3:14540196-14540218 CTCTGGGCAGCAGCTCCAGAGGG + Intronic
950782013 3:15400195-15400217 GTCACGGCACAAATTCTAGAAGG - Intronic
951326131 3:21303595-21303617 TTCTCAGCAGAAACTCTACAAGG + Intergenic
952683753 3:36125248-36125270 TTCTCTGCAGAAACTTTACAGGG + Intergenic
952927688 3:38333462-38333484 GTCTTGGCAAAAACTCAAGATGG + Intergenic
953038941 3:39237811-39237833 CTCTCAGGAGAAACTCCGGAGGG - Intergenic
953233830 3:41088525-41088547 ATCACTGCAGAAACTCTGGAAGG - Intergenic
954557110 3:51526429-51526451 CTCTTGGAAGAAAATATAGAAGG - Intergenic
955164223 3:56494859-56494881 CTCTTGGCACCACCTCTAGAGGG + Intergenic
957204730 3:77181594-77181616 ATTTCTGCAGAAACTTTAGAAGG - Intronic
959361944 3:105404384-105404406 TTCTCAGCAGAAACCCTACAAGG + Intronic
959953887 3:112213005-112213027 CTCTCAGCAGAAACTCTACAAGG + Intronic
960477077 3:118143624-118143646 CTCTCAGCAGAAACTCTACGAGG - Intergenic
961456807 3:127028523-127028545 CTCTGGGCAGAGACTCTGGGAGG + Intronic
963025132 3:140911873-140911895 CTCTTGAGTGAAACTCTAGAAGG - Intergenic
964393466 3:156221413-156221435 TTCTCAGCAGAAACCATAGAAGG + Intronic
966304891 3:178520566-178520588 CTCTCAGCAGAATATGTAGAGGG + Intronic
971708366 4:30078336-30078358 CTCTCAGCAGAAACCCTGCAAGG - Intergenic
975520820 4:75299321-75299343 CTCTTGGCAGAAATGCTACAAGG - Intergenic
975524420 4:75333017-75333039 CTCTCTGCAGAAACCCTACAAGG + Intergenic
975528899 4:75379908-75379930 ATCTCAGCAGAAACTCTACAAGG + Intergenic
975990005 4:80249096-80249118 CTCTGGCCAGAAACTCATGAAGG - Intergenic
976031256 4:80757564-80757586 CTCTGGTAAGAAACTATAGAAGG - Intronic
976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG + Intergenic
977144806 4:93425433-93425455 CTTTCCCCAGAAACTCCAGAAGG - Intronic
978055096 4:104253742-104253764 CTCTTGGCAGAAACCCTACAAGG + Intergenic
978806234 4:112803548-112803570 CTCCCTCCAGAAGCTCTAGAGGG - Intergenic
979417640 4:120462526-120462548 CTCGCTGCAGAAACCCTACAAGG + Intergenic
979421584 4:120510907-120510929 CTCTCTGCAGAAACCCTACAAGG + Intergenic
980787215 4:137571427-137571449 CTTTCAGCAGAAACCCTAAAAGG - Intergenic
982501046 4:156155159-156155181 TTCTCAGCAGAAACACCAGAGGG + Intergenic
983364480 4:166768529-166768551 CTCTTGACAGAAGCTCTAAAAGG - Intronic
985566830 5:623104-623126 CTCTCTGCAGAAACACTAAGAGG - Intronic
986472311 5:8088557-8088579 CTCTCGGCAGAAACCCTACAAGG - Intergenic
988194087 5:27978829-27978851 CTCTCAGCAGAACCCCTACAAGG - Intergenic
988201031 5:28068254-28068276 CTCTCAGCAGAAATTCTATAAGG + Intergenic
991247945 5:64527465-64527487 ATCTTGGCAGAAACTCTAAGTGG - Intronic
994270482 5:97770941-97770963 CTCCTGGCAGAAAGTCTACAAGG - Intergenic
995450988 5:112300489-112300511 TTCTCAGCAGAAACCCTACAAGG - Intronic
995810956 5:116107042-116107064 CTCTCAGCAGAAACCCTAATGGG - Intronic
996648301 5:125842807-125842829 CTCTCTGCAGAAACCCTACAAGG + Intergenic
997182059 5:131840202-131840224 CTCTCAGCACAAACCCTAAAAGG - Intronic
997920098 5:137970259-137970281 CTCTCAGCAGAAACTCTACAAGG + Intronic
998067823 5:139172724-139172746 CTCTCATCAGAAACTTTGGAGGG + Intronic
999839078 5:155404669-155404691 TTCTCAGCAGAAACCCTACAAGG + Intergenic
1004489925 6:16104820-16104842 CTCTCAGCAGCAACTCCAGCTGG + Intergenic
1005330472 6:24745133-24745155 GTCTAGGCAGACAGTCTAGAAGG - Intergenic
1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1006725780 6:36197809-36197831 CACCGGGGAGAAACTCTAGAGGG - Intronic
1007085388 6:39140851-39140873 ATCTCAGGAGAAACTCCAGAGGG + Intergenic
1010483036 6:76377801-76377823 CTCTCAGCAGAAACTCAGAAGGG - Intergenic
1011537554 6:88392503-88392525 CCCTCGGCAGAAACTCTACAAGG + Intergenic
1013007866 6:106091169-106091191 CCGACGGCAGAAACTCTACAGGG - Intronic
1014306830 6:119753497-119753519 TTCTCAGCAGAAACCTTAGAAGG - Intergenic
1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1016423615 6:143911610-143911632 CTCTCAGTGGAAACCCTAGAAGG - Intronic
1024015408 7:45309910-45309932 TTCTCAGCAGAAACTTTACAAGG - Intergenic
1025587004 7:62802814-62802836 CTCTCAGGATAAAATCTAGAAGG + Intergenic
1025593402 7:62892959-62892981 ATCTCAGGAGAAACACTAGAAGG + Intergenic
1026965976 7:74440440-74440462 CTCTAGGCAGATACTGTAGTGGG + Intergenic
1027944225 7:84724390-84724412 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1028580761 7:92407732-92407754 CACTCAGCAGAAACTCCAGGAGG - Intergenic
1029313334 7:99687820-99687842 CTCTTGGCAGAAACTCTACAAGG + Intronic
1030391028 7:108929357-108929379 CTCTCAGTGGAAACTCTACAAGG - Intergenic
1031626942 7:124002991-124003013 CTCTCAGCTGAAACCCTATAAGG - Intergenic
1033163281 7:139016130-139016152 CTCATTGCAGAAAATCTAGAAGG + Intergenic
1034570871 7:151955411-151955433 CTTTCTGCAGAAACTCCAGTTGG + Intergenic
1035558673 8:588428-588450 CTCTCAGCAGAAACTCTACAAGG - Intergenic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1039416936 8:37403482-37403504 GTCTTGACAAAAACTCTAGATGG + Intergenic
1039719019 8:40142539-40142561 CTCTTGGCAGAAACTCTACAAGG - Intergenic
1040273472 8:45984369-45984391 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1041172040 8:55153312-55153334 CCCTCGGGAGAAAAACTAGAAGG - Intronic
1043499386 8:80837921-80837943 CCCTTGGCAGAAACTCCAGTGGG - Intronic
1045199856 8:99969037-99969059 CTCTCGGCAGAAACCCCATAGGG + Intronic
1048126081 8:131636830-131636852 CTCTTGGCAGAAACTCTACAAGG + Intergenic
1050247941 9:3711410-3711432 CTCACAGAAAAAACTCTAGATGG + Intergenic
1051670276 9:19503448-19503470 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1052225102 9:26076472-26076494 CTCTCAGCAGAAACTCTATTAGG - Intergenic
1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1053583089 9:39427081-39427103 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1053616446 9:39770921-39770943 TTCTCGGGAGTAACTCAAGAAGG - Intergenic
1053847272 9:42251940-42251962 CTCCCAGCAGAAACTCTACAAGG + Intergenic
1053874610 9:42530229-42530251 TTCTCGGGAGTAACTCAAGAAGG - Intergenic
1053898001 9:42764359-42764381 TTCTCGGGAGTAACTCAAGAAGG + Intergenic
1054104670 9:60985824-60985846 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1054237072 9:62571468-62571490 TTCTCGGGAGTAACTCAAGAAGG + Intergenic
1054267724 9:62936526-62936548 TTCTCGGGAGTAACTCAAGAAGG + Intergenic
1054551210 9:66605979-66606001 TTCTCGGGAGTAACTCAAGAAGG + Intergenic
1055895014 9:81164228-81164250 CTCTCAGCAGAAACCCTACAAGG + Intergenic
1056941673 9:90961543-90961565 CTGTCGGCAGAAACGCTCCAGGG - Intergenic
1190506073 X:51127021-51127043 CTGTCTGCAGAAACCCTACAAGG + Intergenic
1191919857 X:66244015-66244037 TTCTCAGCAGAAACTCTACAAGG - Intronic
1192000807 X:67149406-67149428 CTCTCAGCAGAAACCCTACAAGG - Intergenic
1192209686 X:69119933-69119955 CTCTCGGCAGAAGCATTCGAGGG - Intergenic
1193095613 X:77545299-77545321 AACTCTGCAGAAACTATAGAAGG + Intronic
1195686137 X:107588094-107588116 CTCTTAGCAGAAACTCTAAAAGG - Intronic
1195733546 X:107990421-107990443 CTCTCTGGAGAAACTCTGCAAGG - Intergenic
1196280991 X:113823886-113823908 CTCTCTGCAGAAACGCTACAAGG - Intergenic
1196473540 X:116056816-116056838 CTCTCAGTAGAAACCCTACATGG - Intergenic
1196513641 X:116544889-116544911 CTCTCAGTAGAAACTCTACAAGG - Intergenic
1196631290 X:117943168-117943190 CTCTCTGCAGAAACCCTACAAGG - Intronic
1199216716 X:145267392-145267414 TTGTCGGCAGAAACCCTATAAGG + Intergenic
1200903501 Y:8457737-8457759 TTCTCAGCAGAAACTCTACAAGG - Intergenic
1201689824 Y:16751371-16751393 ATCTCTGCAGAAACCCTACAAGG - Intergenic