ID: 945500182

View in Genome Browser
Species Human (GRCh38)
Location 2:210563160-210563182
Sequence AGCCAGGTTAAACACAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945500182_945500185 30 Left 945500182 2:210563160-210563182 CCATAGTTGTGTTTAACCTGGCT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 945500185 2:210563213-210563235 TTATTTTATTGCTTACTCAAGGG 0: 1
1: 0
2: 1
3: 42
4: 455
945500182_945500184 29 Left 945500182 2:210563160-210563182 CCATAGTTGTGTTTAACCTGGCT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 945500184 2:210563212-210563234 GTTATTTTATTGCTTACTCAAGG 0: 1
1: 0
2: 0
3: 25
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945500182 Original CRISPR AGCCAGGTTAAACACAACTA TGG (reversed) Intronic
908310491 1:62877077-62877099 AGTCAAGTTAACCACAACCAAGG - Intergenic
908589333 1:65612872-65612894 AGCAAGGTTAACATCAACTATGG - Intronic
912167442 1:107057340-107057362 AGCCAGGTGAAGCAGCACTATGG + Exonic
913217473 1:116632442-116632464 AGCCACTTTCAACATAACTATGG + Intronic
1065184663 10:23160032-23160054 AGTCAGATTAAAAATAACTATGG - Intergenic
1065275293 10:24079535-24079557 AGCCAATTTAAATACAAGTAAGG + Intronic
1067042898 10:42965956-42965978 AGCCATTTTAAAGACAACAAAGG - Intergenic
1068031928 10:51715383-51715405 AGGCAGGTTAAATAAAACTCTGG + Intronic
1074928196 10:118095176-118095198 AGCAAAAATAAACACAACTAGGG - Intergenic
1075976497 10:126700709-126700731 AGCCAGAGAAAACCCAACTAAGG + Intergenic
1076113230 10:127877020-127877042 AGCCAGGTTGAACACTGATAGGG - Intergenic
1081201362 11:40220106-40220128 AGCCTGGTGAAATACAACTGAGG - Intronic
1084910967 11:72388878-72388900 AGCCAGGTTAGAGAAATCTAAGG + Intronic
1089847700 11:121471383-121471405 AGCCAGGTAAAACACATGTAAGG + Intronic
1090338618 11:125994557-125994579 TGCGAGGTTAAACAGAAATAAGG + Intronic
1090436867 11:126694358-126694380 AGCCAGGGGAGACACAACTCCGG - Intronic
1093796724 12:23321757-23321779 GGCCAGGTAACAGACAACTAGGG + Intergenic
1096787287 12:54024478-54024500 AGACAGGGAGAACACAACTAAGG + Intronic
1099989296 12:89707380-89707402 GGGGAGGTTAAACACAACAAAGG + Intronic
1100368810 12:93946279-93946301 AGGCAACTTAAACACAAGTAAGG + Intergenic
1102296952 12:111744685-111744707 CGCCAGGTTAGACACAAATTCGG - Exonic
1109127154 13:58531700-58531722 AGCCAGGTACCAGACAACTAGGG - Intergenic
1120416614 14:84226984-84227006 GGCAAGGTCAAACATAACTATGG - Intergenic
1123668193 15:22626934-22626956 AGCCAGATTGAACACAAATCAGG - Intergenic
1124524170 15:30433373-30433395 AGCCAGATTGAACACAAATCAGG - Intergenic
1124764152 15:32474756-32474778 AGCCAGATTGAACACAAATCAGG - Intergenic
1126154533 15:45553156-45553178 GGCCAGATTAAGCACAATTATGG + Intergenic
1128256951 15:66203706-66203728 ACCCAGGTTAAACAAGACAAAGG + Intronic
1128289031 15:66462800-66462822 AGCCAGTGTAAACACAACAGGGG + Intronic
1128434395 15:67631599-67631621 AGTCAGGCTACACACAACTCAGG + Intronic
1130836933 15:87660324-87660346 AGCCAGGACAAACACAAGTTAGG + Intergenic
1137256519 16:46779350-46779372 AGGCAGGTTAAACACTACAAAGG + Intronic
1140447075 16:75038359-75038381 AGCCAAGCTAGTCACAACTAGGG - Intronic
1141336325 16:83158654-83158676 AGCCACGTTAAACAGATCCACGG + Intronic
1145833541 17:27936784-27936806 AGCCAGGGATAACACAACGAGGG + Intergenic
1151204220 17:72493660-72493682 AGCCAGGTGAAACACATCTATGG + Intergenic
1153093500 18:1374613-1374635 GGCCAGGTTCCAGACAACTAGGG - Intergenic
1155315696 18:24568243-24568265 AGCCAGGTACCAGACAACTAGGG - Intergenic
1157323035 18:46648723-46648745 AGGCAGGTTTAACACAACACTGG + Intronic
927804364 2:26132842-26132864 AGTCAGGTTAAAGACAACCAGGG - Intronic
928038728 2:27852047-27852069 AGCCAGGTCAAGAGCAACTATGG + Intronic
935642431 2:105303825-105303847 AGGCATGTTAAACAATACTATGG + Intronic
936906850 2:117546303-117546325 CGCCAGGTTAATCACACCTGGGG - Intergenic
937357091 2:121204679-121204701 GGCCAAGTTACACAGAACTATGG + Intergenic
941192937 2:162409119-162409141 AGCTAGCTTAAATACATCTAAGG + Intronic
945202500 2:207296675-207296697 AGCCAAGATAAGCACAACTGGGG - Intergenic
945500182 2:210563160-210563182 AGCCAGGTTAAACACAACTATGG - Intronic
1169551360 20:6704686-6704708 AGGAAGGTTATACACAACTAGGG - Intergenic
1169602704 20:7280208-7280230 ACCCAGGTAAAACAGAACAAGGG - Intergenic
1169788765 20:9387457-9387479 AGTCAAGTTCAACACATCTAGGG - Exonic
1170130141 20:13010466-13010488 AGCCTGTTTACACACAACTCAGG - Intronic
1172922158 20:38493451-38493473 ATTTAGGCTAAACACAACTAAGG + Intronic
1173907867 20:46641926-46641948 AGCCAGGTACAAGACAACTAGGG + Intronic
1174655659 20:52170148-52170170 GGGCAGGTTAAACACAGCAAAGG + Intronic
1177442604 21:21146834-21146856 AGACAGGTTAAACAAAATAAAGG + Intronic
1179424662 21:41266237-41266259 AGTCACTTTAAACACAGCTATGG + Intronic
1179465899 21:41572539-41572561 AGCCAGGTACCAGACAACTAGGG - Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1183248758 22:36713458-36713480 AGCCAGGTCAACCACATTTATGG - Intergenic
949597235 3:5560949-5560971 ACACAGGTTAAACAAATCTATGG - Intergenic
958590677 3:96154733-96154755 AGCCAGGAGAAACAGAACTGGGG - Intergenic
960180466 3:114569639-114569661 AGACAGGTAAAACTCACCTATGG - Intronic
960920412 3:122741002-122741024 AGCCTGGTTAAACCCCACTGAGG - Exonic
964289849 3:155165570-155165592 AGCCAGATTAAAGACAACTCTGG - Intronic
965125471 3:164623282-164623304 AGACAGGTGAAAAACAACTCTGG - Intergenic
966718330 3:183036232-183036254 AGCCAGGATGAACCCCACTATGG + Intronic
968244310 3:197126733-197126755 AGACAGGTTAAATACTATTAAGG + Intronic
969849857 4:9947744-9947766 AGCCAGGTATCAGACAACTAGGG + Intronic
970081113 4:12287143-12287165 AACCAGGTGAATCAAAACTAAGG + Intergenic
978312527 4:107400731-107400753 AGGCTGGTTAAATACCACTAGGG - Intergenic
979842556 4:125462645-125462667 ATCCAGGTTTCACAAAACTATGG - Intronic
980321194 4:131278937-131278959 GGCCAGGTTGCAGACAACTAAGG + Intergenic
987476446 5:18397962-18397984 AGCAAGGTCAAAAACAATTATGG - Intergenic
987828604 5:23065092-23065114 AGCCAGGTGACAGGCAACTAGGG + Intergenic
988945761 5:36196851-36196873 CCCCAGGTTAGACACAAATAAGG - Intronic
993434440 5:87873952-87873974 AGTCAGATCAAACACATCTATGG - Intergenic
997926571 5:138035719-138035741 AGGCAGGTTAAAGATGACTATGG - Intronic
1002489549 5:179564820-179564842 AGCTGGGTTAAAAAAAACTAGGG - Intronic
1006815035 6:36844413-36844435 AGCCAGATTAGAAACAACCATGG + Intergenic
1008316179 6:50044190-50044212 AGTCAGGTTAAAAAGAACAATGG - Intronic
1010880299 6:81159752-81159774 AGCCAGGTAACACACAATAAGGG - Intergenic
1012274817 6:97260375-97260397 AGAAAGGTTGAAAACAACTAAGG - Intronic
1013498543 6:110723199-110723221 CGCCAGGTTATACACAAGCAAGG + Intronic
1015592001 6:134831162-134831184 AGCCTTGTTAAACATTACTAAGG + Intergenic
1016782676 6:147977213-147977235 AGCCTGGTCAAGGACAACTAGGG + Intergenic
1020959850 7:14788575-14788597 GGCCAGGTAACAGACAACTATGG + Intronic
1026194567 7:68162007-68162029 AACCACCTCAAACACAACTATGG - Intergenic
1027338587 7:77181311-77181333 TGCCAGGTTCCAGACAACTAGGG - Intronic
1028045772 7:86117116-86117138 AGCCAAGATAAACACAATTGGGG - Intergenic
1034147813 7:148887843-148887865 AGCCAGGCTAAACACAAAGGTGG + Intergenic
1034692082 7:153021901-153021923 GGCCAGGTTGAACACAGCTTGGG + Intergenic
1035520394 8:271578-271600 AGTTGGGTTAAACACAACAATGG + Intergenic
1037229211 8:16634729-16634751 AGCTAAGTTAATTACAACTATGG - Intergenic
1041020263 8:53631803-53631825 GGCCAGGTAACAGACAACTAAGG - Intergenic
1043383490 8:79727080-79727102 AGCCAGGTACCAGACAACTAAGG + Intergenic
1056898479 9:90575002-90575024 AGCCAGGTTGCTCACAACTGGGG + Intergenic
1186095319 X:6094888-6094910 AGTCAGGGTAAATACATCTAGGG + Intronic
1186282342 X:8006715-8006737 ACCCAGGTTATATACAAGTATGG + Intergenic
1186646409 X:11511748-11511770 AGCCAGGTGAAACAGACCTGGGG + Intronic
1189516795 X:41720611-41720633 AGCCAGTTTAAACACTAGTTTGG + Intronic
1194354811 X:92869678-92869700 AGCCAGGTACCAGACAACTAGGG - Intergenic
1196534844 X:116831586-116831608 AGCCAGGTCAAATAAAAGTATGG - Intergenic
1197884775 X:131207080-131207102 AGCCAGGTGAAATATAAATATGG - Intergenic
1198871736 X:141183041-141183063 AGCCAGGTATCAGACAACTAGGG + Intergenic
1199880324 X:151969396-151969418 AGCAATGTTAAACACCACAATGG - Intronic
1200663173 Y:5986698-5986720 AGCCAGGTACCAGACAACTACGG - Intergenic