ID: 945500911

View in Genome Browser
Species Human (GRCh38)
Location 2:210573686-210573708
Sequence GGTTATGTGAGATTACCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945500907_945500911 29 Left 945500907 2:210573634-210573656 CCTGGATAAAAAGAACAAAATGA 0: 1
1: 0
2: 1
3: 104
4: 1121
Right 945500911 2:210573686-210573708 GGTTATGTGAGATTACCAAATGG 0: 1
1: 0
2: 1
3: 15
4: 101
945500906_945500911 30 Left 945500906 2:210573633-210573655 CCCTGGATAAAAAGAACAAAATG 0: 1
1: 0
2: 4
3: 64
4: 815
Right 945500911 2:210573686-210573708 GGTTATGTGAGATTACCAAATGG 0: 1
1: 0
2: 1
3: 15
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945500911 Original CRISPR GGTTATGTGAGATTACCAAA TGG Intronic
901316152 1:8310484-8310506 GGTAATGTCAGTTTCCCAAAGGG - Intergenic
910309934 1:85811939-85811961 TCTTATGGGAGATTACCAAAGGG - Intronic
911338675 1:96611354-96611376 GGTAATGTGAGCATCCCAAATGG - Intergenic
911406758 1:97450745-97450767 GGTTATGTGAAATTACTTATAGG + Intronic
923802433 1:237223171-237223193 TGTTATGACAGAATACCAAATGG + Intronic
923882129 1:238115176-238115198 GGTTATCTCATATAACCAAAGGG - Intergenic
1063333773 10:5188864-5188886 GGTTATGAGAGAATATTAAAAGG + Intergenic
1065385291 10:25127914-25127936 GGTTATTTGAAATGACCAGAGGG + Intergenic
1068950652 10:62773697-62773719 GGTTATGTGAGATAACTAAATGG - Intergenic
1074037244 10:109752817-109752839 GATTATGTCAAATGACCAAAGGG - Intergenic
1079360139 11:19763832-19763854 GGTTTTGTTACATTACCAAAGGG - Intronic
1080362950 11:31537366-31537388 GGTAATGTGGAATTAGCAAAAGG - Intronic
1081069458 11:38593394-38593416 GGTTATGTGAGATCAGATAAGGG - Intergenic
1082759242 11:57110503-57110525 GGTTATGTGATTTCTCCAAATGG - Intergenic
1085281654 11:75334984-75335006 GGTTTTGTGAAATTTGCAAAAGG - Intronic
1087056503 11:93941731-93941753 GGTTATGTACCATAACCAAATGG + Intergenic
1092545605 12:9448821-9448843 GGTTCTGGGAGATGACCAATGGG + Intergenic
1094507348 12:31073230-31073252 GGTTCTGGGAGATGACCAATGGG - Intergenic
1095778403 12:46033733-46033755 GGTTTTGTGAGTTTACATAATGG - Intergenic
1098082240 12:66799775-66799797 GGTTACATGAATTTACCAAAGGG + Intronic
1098604077 12:72369039-72369061 GGGAAAGTGAGATGACCAAAGGG + Intronic
1098741074 12:74174325-74174347 GGTTATTTAAGATTACAAATAGG + Intergenic
1099340857 12:81432011-81432033 GGTTTAGTAATATTACCAAAGGG - Intronic
1099429271 12:82562385-82562407 GTTTATATAAGATTACCAATAGG + Intergenic
1103088546 12:118080907-118080929 GGTTATTTGGGATGACAAAATGG + Intronic
1103376912 12:120463844-120463866 GGTACTGTGAGGTTACCAAATGG + Intronic
1103529806 12:121593073-121593095 AGTTATTTGAGATTTCCAGAAGG - Intergenic
1104421571 12:128640402-128640424 ATTTATGTGAGATTACAGAAGGG + Intronic
1105514840 13:21079874-21079896 GGGTATGTGAACTGACCAAACGG - Intergenic
1107317252 13:39146440-39146462 GGAAATGTGAGATTAACAAATGG - Intergenic
1111946340 13:94669588-94669610 GTTTATGTGAGACTACCCAAGGG + Intergenic
1115828296 14:37302804-37302826 GATTATGTGATATTGACAAAGGG - Intronic
1120533498 14:85663551-85663573 GGTTAAGTGACTTTTCCAAAAGG + Intergenic
1120584109 14:86289719-86289741 GATAATGTGAGAGTAACAAATGG - Intergenic
1124566954 15:30824822-30824844 TGTATTGTGAAATTACCAAATGG + Intergenic
1125588860 15:40842441-40842463 GGTGATGTAATATTACCATAAGG + Intergenic
1126859587 15:52870998-52871020 GGCTATGTGGGATTCCAAAAGGG + Intergenic
1131605404 15:93898612-93898634 GATTATGTGTGATTACATAAAGG + Intergenic
1135784000 16:25331748-25331770 AGTTTCATGAGATTACCAAATGG + Intergenic
1138064655 16:53927942-53927964 GGTTATGCTAGTTTAACAAAGGG - Intronic
1139111585 16:63897992-63898014 GGTAATGAGAGATAACTAAAGGG + Intergenic
1143414134 17:6733756-6733778 GGTTTTGTGAGTTTACATAATGG + Intergenic
1144794796 17:17883767-17883789 GGTCATCTGAGATACCCAAAGGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148883341 17:50750356-50750378 GGTTTGGTGAATTTACCAAAGGG - Intronic
1149060598 17:52416861-52416883 GGTTTTGTGAGATTAACACCTGG + Intergenic
1149164474 17:53734696-53734718 GCTTATGAAAGATTACCAAAAGG + Intergenic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1159016955 18:63109007-63109029 AGTTATATGAGAAAACCAAAGGG + Intergenic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
925734387 2:6948583-6948605 GGTAATGTGAGATTTGGAAATGG - Intronic
926183308 2:10665739-10665761 GGTTACTTGAGATTACCAAGGGG - Intronic
928242357 2:29597486-29597508 GGTTATGTGATTTTAAGAAAAGG - Intronic
929544216 2:42845161-42845183 GTTTATGTGAGATTGCCAACCGG + Intergenic
931036349 2:58247811-58247833 GGTTATGTGTAATTGGCAAAAGG + Intergenic
931161157 2:59691969-59691991 GGTTATGTGAGAAGGCCCAAAGG - Intergenic
931748466 2:65310676-65310698 GGTTATGTCATATTCCCAAGGGG - Intergenic
936101246 2:109581626-109581648 GATTCTGTGAAAATACCAAATGG - Intronic
937286248 2:120754111-120754133 CCTTATGAGAAATTACCAAATGG - Intronic
939024277 2:136993598-136993620 GTTCATGTGACATTACCAAAAGG + Intronic
939231761 2:139435712-139435734 GGTTATGTGACCTGACAAAAAGG + Intergenic
943989494 2:194669448-194669470 GTTTAAGGGGGATTACCAAATGG + Intergenic
944456284 2:199898181-199898203 GGTTCTGTCATATTACCAGAGGG - Intergenic
945500911 2:210573686-210573708 GGTTATGTGAGATTACCAAATGG + Intronic
946543008 2:220706531-220706553 GGCAATCTGAGATTAGCAAAGGG - Intergenic
1170381599 20:15766130-15766152 TGTTATTAGACATTACCAAAGGG - Intronic
1170861332 20:20106286-20106308 GGTTTTATGAAATAACCAAAAGG - Intronic
1174994949 20:55555924-55555946 GATTTTGTGAGATTAACAAATGG + Intergenic
1175032303 20:55967960-55967982 GGATATGTGAGAAAAGCAAAGGG - Intergenic
1176968649 21:15240113-15240135 AGTTAGGTTAGATTTCCAAAAGG + Intergenic
1182673060 22:32014114-32014136 GGTCATTTGAAATTATCAAAAGG - Intergenic
1185018744 22:48360874-48360896 GGTGGTGAGAGGTTACCAAAAGG + Intergenic
951517793 3:23580939-23580961 AGTTACGTGACATTACCATAAGG - Intronic
952428883 3:33202748-33202770 GTTTAAGTGAGATCACCACAGGG + Intronic
958146170 3:89628557-89628579 GGTTATGTAGCATGACCAAAAGG - Intergenic
960472189 3:118079959-118079981 GTTTATAAGAAATTACCAAATGG - Intergenic
966888945 3:184392414-184392436 GGATATGTGAAATTGCCACAGGG + Intronic
972462246 4:39315560-39315582 GGTTATGTGAGATGTCCACATGG - Intronic
973539777 4:51924410-51924432 AGTTGTGTGCTATTACCAAAAGG - Intergenic
976035975 4:80821544-80821566 GGCTGTGTGAGATTTGCAAAGGG - Intronic
977448778 4:97166924-97166946 GGCTAATTGAGATTTCCAAAGGG + Intergenic
977507560 4:97921577-97921599 GGTTATTTGAAATTACCCAGAGG + Intronic
982634384 4:157874439-157874461 GGATATGGGAGATTAATAAATGG + Intergenic
990247690 5:53879473-53879495 GGTGATTTGAAATTAACAAATGG + Intergenic
991596882 5:68315484-68315506 GGCCATGTGATATTACCAGATGG + Intergenic
1000872479 5:166593900-166593922 GGTCATCAGAGTTTACCAAATGG - Intergenic
1000927050 5:167206556-167206578 GTTTATGTGAGATTGCTCAATGG - Intergenic
1009032505 6:58077019-58077041 GATTACGTGAGATTATCAAAAGG + Intergenic
1009208114 6:60828792-60828814 GATTACGTGAGATTATCAAAAGG + Intergenic
1009991115 6:70843885-70843907 GGTCATGGGAGATCACCAAGAGG + Intronic
1012671040 6:102047865-102047887 GATTATGTGAAATTACAAAAAGG + Intronic
1013263086 6:108466310-108466332 GTATATATGAGTTTACCAAAAGG + Intronic
1016644965 6:146396799-146396821 GCTTATGTCTAATTACCAAATGG + Intronic
1019047114 6:169157744-169157766 GGTTGTGTGAGATTTCCTAGAGG + Intergenic
1020605249 7:10328909-10328931 GTTTATGGGAGAATATCAAAAGG + Intergenic
1021380232 7:19957102-19957124 ATTTATGTGTGATGACCAAAGGG + Intergenic
1024922029 7:54568120-54568142 AGTAATGTGAGTTTACTAAATGG + Intronic
1028398238 7:90395872-90395894 TGTTGTGTGAGATTACCATGAGG - Intronic
1030037914 7:105423796-105423818 GATTAGGAGAGATTACCACAGGG - Intergenic
1032443723 7:131962178-131962200 GGGTTGGTGAGATTACCTAAGGG - Intergenic
1033551039 7:142448298-142448320 GGCTGTCTGAGATTAACAAAGGG - Intergenic
1033951088 7:146786032-146786054 GCTGATGTGAGCTTCCCAAACGG - Intronic
1036759632 8:11498419-11498441 GTTTTTGTCAGATTCCCAAAGGG + Intronic
1039348458 8:36734193-36734215 GGTTAAGTGAGATTCCCAGGTGG + Intergenic
1043290246 8:78590220-78590242 GGTTATGTAAATTTCCCAAACGG - Intronic
1043840530 8:85098387-85098409 GATTATGAGAGATTACTTAATGG + Intergenic
1044783163 8:95764256-95764278 GGTTATATGTGATGACCAAGTGG + Intergenic
1045623415 8:104010795-104010817 GGTTTTATCAGATTACCAAAGGG - Intronic
1049652606 8:143779437-143779459 GGATACGTGAGATAAGCAAATGG - Intergenic
1051065875 9:13102425-13102447 TGTTATTTGAAATTTCCAAAAGG - Intergenic
1052905428 9:33829408-33829430 AGTGATGAGAGATTACCTAATGG + Intronic
1055802275 9:80051583-80051605 GGTTATGTGAGATGAGGAATAGG + Intergenic
1057608593 9:96520285-96520307 GTTTTTGGGATATTACCAAAAGG + Intronic
1059109896 9:111546455-111546477 GATTAAGTCAGATTATCAAAAGG + Intronic
1187820360 X:23281085-23281107 CGTTATTTAAGATAACCAAAAGG + Intergenic
1188405282 X:29800240-29800262 GGTCATGTGATTTTACCACAAGG - Intronic
1193426497 X:81346431-81346453 GGTTATGTCAGACTTGCAAATGG - Intergenic
1198305655 X:135380164-135380186 GGTTATGTCAGGTTTCCCAAAGG - Intergenic