ID: 945500919

View in Genome Browser
Species Human (GRCh38)
Location 2:210573719-210573741
Sequence GGGAGGTATGGGTCTGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945500915_945500919 -5 Left 945500915 2:210573701-210573723 CCAAATGGTTTCTGTAAGGGGAG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945500919 2:210573719-210573741 GGGAGGTATGGGTCTGATTAAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945500919 Original CRISPR GGGAGGTATGGGTCTGATTA AGG Intronic
900524538 1:3122031-3122053 GCGGAGTATGGATCTGATTAGGG + Intronic
902619015 1:17639804-17639826 GGGAGGAATGGGTCTCACTTGGG - Intronic
903443028 1:23402487-23402509 GGGAGGGATGGGTATGTTTAAGG - Intronic
905732579 1:40306720-40306742 GGCAGGTTGGGGTCAGATTATGG + Intronic
907662729 1:56407958-56407980 GGAAGGTATGAGTCTGAGTTTGG - Intergenic
907742752 1:57183148-57183170 GGGAGTGAGGGGCCTGATTATGG + Intronic
907911785 1:58833608-58833630 GGTAAGTAGGGGTCTGAGTACGG + Intergenic
912629883 1:111237674-111237696 GGGAGGTAAGAGGCTGATTTTGG - Intronic
913706702 1:121432519-121432541 GAGAGGTGTGGGTGGGATTAAGG - Intergenic
914798742 1:150943713-150943735 GGGAGGTATTGGTTAAATTAAGG + Intronic
922240199 1:223750777-223750799 AGGAGGTATGGGGCTGAGGACGG - Intronic
924927669 1:248698991-248699013 GGGAGATGGGGGTCTGATTCTGG - Intergenic
1064129584 10:12697086-12697108 GGAAGGTATGGGTCAAAGTAGGG + Intronic
1065359605 10:24877169-24877191 TGGTGGTATGTGCCTGATTAAGG - Intronic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1071806652 10:89129178-89129200 GGCAGGTGTGGATCTGTTTAGGG + Intergenic
1072192523 10:93087812-93087834 AGGAGGTATGTGTGTGATTGTGG + Intergenic
1072662125 10:97369622-97369644 GGAAGGTTTGGGTCTGAGTGGGG - Intronic
1079668403 11:23135623-23135645 GGGAGGTATGGGCCTGTTGATGG + Intergenic
1083937428 11:65877410-65877432 AGGAGGTTTGGGTCTGTTTTTGG - Intergenic
1084409841 11:69000465-69000487 GGGAGGTATGTGTGTATTTAAGG - Intergenic
1085645369 11:78219089-78219111 GGGAGGTGAGGGCCTGATCAAGG - Exonic
1095876414 12:47083701-47083723 AGGAGGCATGGGTCAGCTTATGG + Intronic
1097021690 12:56025373-56025395 AAGAGGTATGGGTGGGATTAAGG + Intronic
1097102889 12:56601779-56601801 GGGAGCTATGGCTCTGAGTCTGG + Exonic
1099498255 12:83378875-83378897 GGGAGGTATGGATCTGTTGCTGG + Intergenic
1105497663 13:20945025-20945047 GGGCCGTATGAGTCTTATTAAGG - Intergenic
1113223353 13:108130429-108130451 GGGAGGTAGAGTTCTGACTAAGG + Intergenic
1113500500 13:110770308-110770330 AGGAGGTAAGGGTTGGATTAGGG + Intergenic
1124404160 15:29379394-29379416 GGGAGGTTAGGGTATCATTAGGG - Intronic
1124660366 15:31545134-31545156 TGTAGGTGTGGGTCTGATTCTGG - Intronic
1126474356 15:49050684-49050706 GGGAGGTGTGGGTATGTATAAGG + Intergenic
1128614975 15:69101864-69101886 GGGAGGAATGGGGATGATGAGGG + Intergenic
1129028760 15:72604047-72604069 GGGAGCTGTGGGTTTGTTTATGG + Intergenic
1134351621 16:13443012-13443034 GTGAGTTATGGCTCTGATGAAGG - Intergenic
1134746438 16:16592772-16592794 GTGAGGTGTGGGTCAGGTTAGGG - Intergenic
1134999042 16:18760928-18760950 GTGAGGTGTGGGTCAGGTTAGGG + Intergenic
1138558884 16:57788355-57788377 GGGAGGCATGGGTGAGATGAAGG + Intronic
1139640294 16:68286794-68286816 GGGAGGTATGGGTAGGAATGAGG + Intronic
1141948422 16:87325435-87325457 GGGAAGTGTGGATCTGATAAGGG - Intronic
1142415493 16:89938963-89938985 GGCAGGAATGGGCCTAATTAAGG + Intergenic
1144016341 17:11199960-11199982 GGGAGGTATGGGTCTCTGTTGGG + Intergenic
1148362837 17:47027388-47027410 GAGAGGTATGGGTAGGGTTAGGG + Intronic
1148871797 17:50662809-50662831 GGGAGGCCTGGCTATGATTATGG + Intronic
1149220037 17:54406480-54406502 GGCAAGTGTGGGTATGATTAAGG + Intergenic
1154181424 18:12142783-12142805 GGGAGGTATGGAGCTGTTGACGG + Intergenic
1154182480 18:12148801-12148823 GGGAGGTATGGAGCTGTTGACGG - Intergenic
1154280955 18:13003130-13003152 GGTCAGTATGGGTCTCATTATGG + Intronic
1166676902 19:44746429-44746451 AGGAGGTAAGGGTCTGATGGAGG - Intergenic
1168526324 19:57091320-57091342 TGGAGGTAAGGGTCTGGTGAGGG + Intergenic
925942188 2:8831304-8831326 GGGAGGGATGGGGCTGAGGAGGG - Intronic
926408709 2:12579962-12579984 AGCAGGTATGGGTCTGATCAAGG + Intergenic
927374696 2:22400445-22400467 GGGAGGTATGAGGCTGGTGAAGG - Intergenic
932462914 2:71894878-71894900 CGGATGTCTGGGTCTGATGATGG + Intergenic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
938837094 2:135115950-135115972 GGGGGGAATGGGGCTGATGAGGG + Intronic
942453365 2:176122248-176122270 GGGAGGGGTGGGTGTGAGTAGGG + Intergenic
942519697 2:176790765-176790787 GGAAGGTGTGGGGCTGCTTAAGG - Intergenic
942964250 2:181871151-181871173 GGGAAGTATGATTTTGATTAGGG - Intergenic
944927011 2:204475821-204475843 GGGAAATATGGGTTTGGTTATGG + Intergenic
945500919 2:210573719-210573741 GGGAGGTATGGGTCTGATTAAGG + Intronic
946178010 2:217933653-217933675 GGGAGGTCTGGGTGTGCTTCAGG - Intronic
1169511061 20:6264248-6264270 TGGAGGTGTTGGTCTGATTCTGG + Intergenic
1169843579 20:9965808-9965830 AGGAGGTATGGGTAGGGTTAAGG + Intergenic
1170000124 20:11606143-11606165 GGGTGGTGTGTGTCTGATCATGG - Intergenic
1170552440 20:17489379-17489401 GGGTGGTATGGCGCTGGTTATGG + Intergenic
1170895251 20:20406977-20406999 GGTAGCTACGGCTCTGATTATGG + Intronic
1172986589 20:38996409-38996431 GGGAGGTTGGGGTCAGATGACGG + Intronic
1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG + Intergenic
1183563943 22:38599349-38599371 GGGAGGAATGTGTCTGAGGAGGG + Intronic
1184024700 22:41846486-41846508 GGGAGGGTCGGGTCTGATGATGG + Intronic
1184326245 22:43789122-43789144 GGGAGGAATGGGACTGCTGATGG + Intronic
949937095 3:9124372-9124394 GGGAGGTAGGGGTCTCACCAGGG + Intronic
951204071 3:19907461-19907483 GGGAGGTATGGCAATGATTTAGG + Intronic
951980365 3:28559535-28559557 GGGTGGATTGAGTCTGATTATGG + Intergenic
952258399 3:31715058-31715080 GGGAAGTATGGGTCAGATTGAGG - Intronic
954875603 3:53801117-53801139 GGGTGGTATTGGTCTGCTGAAGG - Exonic
954910334 3:54101247-54101269 GGTAAGTATGGGTCTGTTTCTGG + Intergenic
961059195 3:123814012-123814034 GGGAGACATGGGAGTGATTAGGG - Intronic
964219333 3:154325993-154326015 GGTAGATAGGGGTCTGATTATGG + Intergenic
964428565 3:156579530-156579552 GGAAGGGATGAGTATGATTAGGG + Intergenic
969419294 4:7082237-7082259 GGGAGTTTCGGGGCTGATTAAGG - Intergenic
974397000 4:61350449-61350471 GTGAGGTATGTGTCTAATTGGGG - Intronic
974688064 4:65257499-65257521 GGGAGATGAGGGTCAGATTATGG + Intergenic
975209981 4:71688725-71688747 TGGAGGCATGGGTAGGATTAAGG - Intergenic
978451657 4:108840530-108840552 GGCAGGTATTGGTCTGACTCAGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984118011 4:175706611-175706633 GAGAGGTATAGGTCTGTTTGAGG + Intronic
999106377 5:149074921-149074943 GTGAGGTATGGGGTTGGTTATGG - Intergenic
1000031650 5:157406932-157406954 GGGAGGTATGGGCCTGTTGCTGG - Intronic
1000308518 5:160018592-160018614 AGTAGGCAAGGGTCTGATTATGG + Intronic
1014846127 6:126279297-126279319 TGTAGGCATGGGTATGATTATGG + Intergenic
1016129214 6:140444937-140444959 GGGTGGTCTGGGCCTGAGTATGG - Intergenic
1017013290 6:150079642-150079664 GGGTGGTAGGTTTCTGATTATGG - Intergenic
1021524424 7:21571225-21571247 GGGAGTTATGTGTCTAGTTATGG + Intronic
1021713298 7:23437939-23437961 GGGAGGTATGAGTTTGAATTTGG - Intronic
1024316741 7:48026987-48027009 GGGAGGTATAGGGTTGATAAGGG - Intronic
1025798893 7:64765702-64765724 GGGAGGTATAGTAGTGATTATGG - Intergenic
1029837094 7:103323851-103323873 GGGCGGTGTGGTTTTGATTATGG - Intronic
1032248915 7:130236197-130236219 GGGAGGTAAGGGGCTGAGGAAGG + Intergenic
1032786315 7:135203250-135203272 GGGAGGTAGGGGTCTGCCTCAGG - Intronic
1039514494 8:38120589-38120611 GAGAGGAATGGGGGTGATTAGGG - Intronic
1039593303 8:38768753-38768775 GGGAGGTATGTGTGTGACTGTGG + Intronic
1039597347 8:38802490-38802512 GGGAGGTAGGGGTATGGTTTTGG - Intronic
1045088970 8:98719106-98719128 GGGAGGTAGGAGTGTGTTTAGGG + Intronic
1046338893 8:112826073-112826095 GGGAGGGATGGGTCAGGTTCAGG + Intronic
1049415831 8:142494706-142494728 GGGAGGTTGGGGTTTGGTTACGG - Intronic
1049471477 8:142776826-142776848 GGGAGGTGGGGGTTGGATTACGG + Intronic
1054896896 9:70323679-70323701 GGGAGGGAAGGTTTTGATTAAGG + Intronic
1057793931 9:98142645-98142667 GGGAGGTGTGTGTCTGAATGGGG - Intronic
1057840641 9:98483265-98483287 TGGAGGGTTGGGACTGATTAAGG - Intronic
1058973023 9:110100511-110100533 GTGAGGTAGGGGTCTGAGAAAGG + Intronic
1186326844 X:8487259-8487281 GTTAGGTATGGTTCTGCTTAAGG + Intergenic
1187936453 X:24340931-24340953 TGGGGGTAGGGGTCAGATTATGG + Intergenic
1191643911 X:63458084-63458106 GAGAGGTAAGAGTCTGATGATGG + Intergenic
1194794904 X:98199460-98199482 GGGAATTATGGGTTTGATTTAGG - Intergenic
1196116714 X:112006719-112006741 GCGAGGTTTGGGTTTGATTCTGG + Intronic
1197759762 X:130019743-130019765 GCGAGGCATGGGTCAGCTTAGGG + Intronic