ID: 945504456

View in Genome Browser
Species Human (GRCh38)
Location 2:210621125-210621147
Sequence CAGCTTCCCTACCATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945504456_945504459 12 Left 945504456 2:210621125-210621147 CCAAGGGCATGGTAGGGAAGCTG 0: 1
1: 0
2: 4
3: 24
4: 229
Right 945504459 2:210621160-210621182 AGTTCCCCAAATTTATAGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 163
945504456_945504458 8 Left 945504456 2:210621125-210621147 CCAAGGGCATGGTAGGGAAGCTG 0: 1
1: 0
2: 4
3: 24
4: 229
Right 945504458 2:210621156-210621178 AGGCAGTTCCCCAAATTTATAGG 0: 1
1: 0
2: 1
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945504456 Original CRISPR CAGCTTCCCTACCATGCCCT TGG (reversed) Intronic
900459461 1:2795480-2795502 CAGCTTCCTTACATGGCCCTGGG + Intronic
900584365 1:3425398-3425420 CAGCTTCCCCAGGATGCCTTTGG + Intronic
901511417 1:9719848-9719870 CAGCTTCCCTGCCCTCCCCCAGG - Intronic
901843167 1:11966285-11966307 CAGCTTCCCTGCCAGGGCTTTGG - Exonic
903286032 1:22277314-22277336 CAGCTTCCCCTTCAGGCCCTGGG + Intergenic
904312997 1:29641478-29641500 CAGCTACTCCACCCTGCCCTTGG - Intergenic
908532921 1:65050557-65050579 CAGCTGCCCCATGATGCCCTGGG - Intergenic
909519304 1:76548494-76548516 CAGCATCACTTCCATGCCCCAGG + Intronic
910846740 1:91611618-91611640 CAGCTTCCTTGCAAAGCCCTGGG - Intergenic
912746541 1:112249957-112249979 CAGCTTCCCCATCATGCCCAGGG + Intergenic
915249780 1:154579755-154579777 CATCTTCCCCACACTGCCCTTGG + Exonic
915281104 1:154822707-154822729 CTGCCTCCCTCCCCTGCCCTTGG - Intronic
916246184 1:162690476-162690498 CAGCATACCTACCATGTGCTAGG + Intronic
916712404 1:167423560-167423582 CATCTTCCCTACCAGGTCCAAGG - Exonic
918052676 1:180988253-180988275 CAGCTCCCCTCCGATGCGCTGGG + Exonic
921945733 1:220884741-220884763 CAGCCTCCCAACCATGGGCTGGG + Exonic
922214007 1:223506409-223506431 CAGCTTCCCTGCCATGCTTCAGG + Intergenic
1063073521 10:2690915-2690937 CAACTTCCCTGCCATGCTCTGGG + Intergenic
1064456027 10:15488225-15488247 CAGATTCCTTACCGTGGCCTGGG + Intergenic
1066555887 10:36612557-36612579 CAGTTTCCCTGCCTTGCCCGTGG + Intergenic
1067851591 10:49758364-49758386 CAGCATCCCCACCCTACCCTGGG - Intronic
1068532838 10:58208965-58208987 CAGCTTCCCTACCAAGTCAGCGG + Intronic
1068572435 10:58645078-58645100 GAGCTTCCCTACTTTGACCTAGG - Intronic
1068628540 10:59275373-59275395 CAGGTTGTCTACCAAGCCCTGGG + Intronic
1069559063 10:69416899-69416921 CAGCTTCCCTGCCGTTCTCTGGG + Intergenic
1069760216 10:70805253-70805275 GAGTTTCCATAACATGCCCTGGG - Intergenic
1070322075 10:75362055-75362077 CAGCTTCCCTACCAGCCCCAGGG + Intergenic
1070518028 10:77225947-77225969 CATCTTCCCGTCAATGCCCTGGG + Intronic
1071259341 10:83905934-83905956 AGGCTTACCTACCATACCCTGGG + Intergenic
1071858394 10:89648330-89648352 CTTCTTCCCTACCATACGCTGGG - Intergenic
1072334149 10:94382484-94382506 CAGGTTCACTGCCATGGCCTAGG + Intergenic
1072611683 10:97021287-97021309 CAGCTTGCCCTCCATGTCCTGGG + Exonic
1072628464 10:97129632-97129654 TACCTTCCCTCCCCTGCCCTGGG + Intronic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1072964026 10:99955865-99955887 CTGCTTCCATAACAAGCCCTTGG + Exonic
1073205095 10:101764871-101764893 CAGCTTCTCTAACAAGCCCAGGG - Intergenic
1074031538 10:109693835-109693857 CAAGTTCCCTAACATGCCTTAGG - Intergenic
1075182258 10:120222201-120222223 CAGCTTCCCCAGCATCCTCTTGG + Intergenic
1076616225 10:131756645-131756667 CCACTTCCCCACCATGCCCAGGG + Intergenic
1078356521 11:10635962-10635984 AAGCTTCCCTTCCATGTCCCGGG - Intronic
1078510313 11:11979906-11979928 CAGCCTGCCTTCCAGGCCCTGGG + Intronic
1081811691 11:45917800-45917822 CAGCTTCTCCATCCTGCCCTCGG + Exonic
1081906491 11:46673609-46673631 CAGGTTCTCTACACTGCCCTGGG + Intronic
1083796256 11:65018503-65018525 CACCTTCCCTGCCCTGCTCTGGG - Intronic
1083816839 11:65137599-65137621 TACCATCCCTACCATGCCCCAGG + Intergenic
1083913999 11:65728162-65728184 CAGCTTCCCAACCATGGTCCTGG - Intergenic
1086268290 11:85028527-85028549 CAGCCTCCCTCCCATGCTCACGG + Intronic
1086950733 11:92887809-92887831 CTGCTTCCCTCCCCTGCCCTGGG - Intronic
1087250524 11:95893769-95893791 CTACTTCCCTACCATCCCTTGGG + Intronic
1089113863 11:116078355-116078377 CTCCTTCCCTTCCCTGCCCTTGG - Intergenic
1089689603 11:120179106-120179128 CAGCTTCCCTCTCTGGCCCTTGG - Intronic
1090930405 11:131292834-131292856 CAGTTTCCCCATCATGCCCCAGG + Intergenic
1092441545 12:8509137-8509159 CAGCTGCCCTGCCTTGACCTAGG - Intergenic
1093478004 12:19575882-19575904 CTGCTTTCCCACCAAGCCCTGGG - Intronic
1093728692 12:22544136-22544158 CAGCTTCCCTGGCATGGTCTCGG + Exonic
1096337417 12:50766793-50766815 CAGCTTCCCCACCCTGCCACAGG + Intronic
1096714980 12:53485964-53485986 CGGCTTCCAAACCATGCCCTAGG - Intronic
1097990475 12:65826532-65826554 CAGTTTCCCCACCTTGCTCTCGG - Intronic
1098241509 12:68472237-68472259 TAGCTTGCCTACCATGACCTAGG + Intergenic
1098508489 12:71283161-71283183 CAGGTTCCCTTCCAAGCACTAGG + Intronic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1104425885 12:128677724-128677746 CAGCATCCCCACCCTGTCCTGGG - Intronic
1104948567 12:132428449-132428471 CAGGGTCCCTCCCGTGCCCTGGG + Intergenic
1104958416 12:132476964-132476986 CAGCTTCCCCACCAGCCCCCAGG + Intergenic
1105601325 13:21891280-21891302 CAGGCTCCCCACCCTGCCCTGGG - Intergenic
1107353593 13:39542158-39542180 CAGCCTCCCTCACATGCCTTTGG - Intronic
1108356734 13:49635113-49635135 CAGCTGCCCTTTCATGCCATAGG + Intergenic
1111657189 13:91168398-91168420 CAGCTTCCATAACTTGCCCAAGG + Intergenic
1113489621 13:110680903-110680925 CAGCCTCTCTGCCCTGCCCTGGG - Intronic
1118756760 14:68850545-68850567 CTGCTTCCCTCCCAGGTCCTGGG + Intergenic
1118844606 14:69537694-69537716 CAGCTTCTCTGCCATTCTCTTGG + Intergenic
1121409897 14:93742591-93742613 CACCTCCCCTACCCTGCCCAAGG - Intronic
1122267107 14:100551851-100551873 CCCCTTCCCCACCATGCGCTGGG - Intronic
1123911938 15:24976918-24976940 CAGCTGCCCTACCAACCCCAGGG - Exonic
1127992306 15:64129337-64129359 CAGCGTCCTTTCCATGCCCTAGG + Intronic
1128466581 15:67917809-67917831 CTGCATCCCGCCCATGCCCTGGG - Intergenic
1129293461 15:74586129-74586151 CAGCTTCCCAAGTATGCCCTGGG + Intronic
1129702599 15:77776314-77776336 CACCCTCCCTGCCATGCCCAGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132808748 16:1787784-1787806 CTGCGTCCCTACCAGCCCCTGGG + Exonic
1133965807 16:10530942-10530964 CAGCCTCCCTACCATGCCACAGG + Exonic
1133996654 16:10753501-10753523 CAGCTTCCATGCACTGCCCTTGG - Intronic
1135569154 16:23535052-23535074 CTGCTCCTCTACCAGGCCCTGGG - Exonic
1136026801 16:27473870-27473892 CAGCTTCCCTCCAGTGCTCTAGG - Intronic
1137505669 16:49051852-49051874 CAGTTTCCATCCCAGGCCCTTGG - Intergenic
1139364345 16:66424603-66424625 CAGCATCCCTACCTATCCCTAGG + Intergenic
1140189929 16:72806773-72806795 CAGTTTCCCTTCCATGCTCCTGG - Intronic
1142987526 17:3705414-3705436 CAGCTTCCCTACCTTTGCCCAGG + Intergenic
1143506805 17:7370714-7370736 CAGCTTCCTTACCTTGCAGTGGG - Intergenic
1143520979 17:7444245-7444267 CAGCTTCCCTACTATGAGCCAGG - Exonic
1145047646 17:19630805-19630827 GAGGTTCCTTACCATGCCATGGG - Intergenic
1147311822 17:39600023-39600045 CAGCTTCCCTTCCCTGCCCTAGG + Intergenic
1147638153 17:41976531-41976553 CCGCCTCCCTCCCCTGCCCTCGG + Exonic
1148716149 17:49717597-49717619 CAGCTCTCCTTCCATGTCCTTGG - Exonic
1149430880 17:56594783-56594805 CGGCTTGCACACCATGCCCTCGG - Exonic
1151130423 17:71891091-71891113 CATCCTCCCTTCCCTGCCCTGGG - Intergenic
1151574778 17:74947300-74947322 CTGCTTTCCTGCCAGGCCCTCGG - Exonic
1152207461 17:78981802-78981824 CACTTTCCCTACCATGTCTTGGG - Intergenic
1152379506 17:79935017-79935039 AGGCTGCCCTACCAAGCCCTTGG - Exonic
1158244405 18:55414674-55414696 CAGCCTCTCTACCATTGCCTGGG - Intronic
1158851885 18:61503022-61503044 AAGCTGCCCTCCCATGTCCTTGG - Exonic
1160889517 19:1369846-1369868 CAGCATCCCGAGCCTGCCCTGGG + Intronic
1163087513 19:14992999-14993021 CAGCTTCCCCACCGTTCCCAGGG + Intronic
1164972892 19:32547703-32547725 CATCTCCCCTACTCTGCCCTAGG + Intergenic
1165139378 19:33689781-33689803 CAGTTTCCCTGCCCAGCCCTGGG + Intronic
1167384202 19:49154670-49154692 CATCTTCCCCATCATGGCCTCGG + Exonic
1168056197 19:53866573-53866595 CTGCATCCCTTCCCTGCCCTGGG + Intronic
1168311598 19:55463584-55463606 CCCCTTCCCCAGCATGCCCTGGG - Intergenic
925411650 2:3643153-3643175 CTGGTTCCCAACCCTGCCCTGGG + Intronic
925537000 2:4928693-4928715 CAGCTTCAATGCCATGCGCTCGG - Intergenic
925922007 2:8644766-8644788 CAACTTCTACACCATGCCCTAGG + Intergenic
926701358 2:15806178-15806200 CAGATACCGTACCAGGCCCTGGG - Intergenic
926703830 2:15822509-15822531 CAGCTTCCCAAAAAGGCCCTGGG + Intergenic
927869535 2:26614799-26614821 CAGCTTCCTTACCTTGAACTTGG - Intronic
927908590 2:26880373-26880395 CTGCTTCCTTACCCTGGCCTGGG - Intronic
927955841 2:27206827-27206849 CAGGTCCCCCAACATGCCCTAGG + Intronic
930741571 2:54837198-54837220 CACCTTCAGTACCATGTCCTGGG + Intronic
933728972 2:85443062-85443084 CAGCTTCACTACCAGTCTCTAGG + Intergenic
933778541 2:85786454-85786476 CAGCTTCCTTGCGCTGCCCTAGG - Intronic
933842424 2:86298269-86298291 CATCTGCCCTTCCATGCCCAGGG - Intronic
937202997 2:120217769-120217791 CGGCTGCCACACCATGCCCTCGG - Intergenic
937877704 2:126837679-126837701 CAGCTCCCCCACCCTGCCATGGG - Intergenic
940250651 2:151672211-151672233 CAGCTTGTCTACCATGCCTTTGG + Intronic
941172990 2:162162516-162162538 CAGCTTCCACACCATGACCGTGG - Intergenic
942601660 2:177646808-177646830 CATCTACTCTACCCTGCCCTGGG + Intronic
944229156 2:197376041-197376063 CGGCTTCCCCTCCATGCCCTCGG + Intergenic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
944505052 2:200402475-200402497 CACCTTCCCTCCCATTCCCCTGG + Intronic
945021175 2:205573145-205573167 CCGGTTCCCTACCATGACGTGGG + Intronic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
946371368 2:219283498-219283520 CAGCTCCCCTACCCAGCCCCTGG + Intronic
948006153 2:234609493-234609515 CAGCATCCCTTCCAAGCCCCAGG + Intergenic
948795363 2:240399710-240399732 CAGCTTCCCTAGCCTTCCCAGGG + Intergenic
1168951771 20:1807058-1807080 CAGTTTCCCTTCCATATCCTAGG - Intergenic
1170160685 20:13307191-13307213 CAGCATTCCTCCCATCCCCTCGG + Intergenic
1170798978 20:19574855-19574877 GAGATCCCATACCATGCCCTGGG + Intronic
1172945881 20:38688820-38688842 CAGCTTCCCGAGCTGGCCCTTGG - Intergenic
1174267198 20:49340468-49340490 CAGTTTCCCTGCCATCCCCGAGG - Intergenic
1175925890 20:62471162-62471184 CTGCTGCCCTGCCCTGCCCTGGG - Intronic
1176082564 20:63281371-63281393 CACCGTCCCCACCAGGCCCTCGG + Intronic
1177769198 21:25496122-25496144 CAGCTTCCTGACCATTCCCAGGG - Intergenic
1179586542 21:42377031-42377053 CAGTTTCCCTCCCATAACCTGGG - Intronic
1183001994 22:34868299-34868321 CAGCTTCACTGCAATGGCCTTGG + Intergenic
1183077400 22:35435726-35435748 CAGCCTCCCTAACTTGGCCTTGG + Intergenic
1183329531 22:37211971-37211993 CAGGTTCCCTCCCAGGCCCTCGG + Exonic
1183702562 22:39458153-39458175 CAGGTTCCCTCCCCCGCCCTGGG - Intronic
1183796499 22:40122860-40122882 CAGCTTCCCTACCAAAACTTGGG - Intronic
1184599967 22:45537711-45537733 CAGCTTCCCTGTCATCCCCTGGG + Intronic
1184853564 22:47134698-47134720 CAGCTTCACTACCAAACCCCTGG + Intronic
1185087395 22:48748372-48748394 CAGCTTCCTTTCCAGGCCCCAGG + Intronic
950193477 3:10993272-10993294 CCGCGTCCCCTCCATGCCCTGGG - Intronic
951264762 3:20552651-20552673 CGGCTTCCCTCCCATGCTCCTGG + Intergenic
952743847 3:36760069-36760091 CAGCTTCCTTCAAATGCCCTAGG - Intergenic
954654285 3:52184570-52184592 CAGCTTGGCTCTCATGCCCTTGG + Intergenic
954791247 3:53135020-53135042 CAGCTGCATTATCATGCCCTGGG - Intergenic
956345549 3:68274001-68274023 CAGCTTTCTTGCCAGGCCCTAGG + Intronic
957683282 3:83467728-83467750 CTGCTTGCCTTCCATGCCCTTGG + Intergenic
960638841 3:119809062-119809084 CAGCTTCCCAGGCCTGCCCTCGG + Intronic
961316270 3:126037919-126037941 CTGCTTCCCTACACAGCCCTGGG + Intronic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
961828910 3:129613263-129613285 GTGCTTCCCTGCCCTGCCCTCGG + Intergenic
962347112 3:134626269-134626291 AGACTTCCCTACCATACCCTGGG - Intronic
962653740 3:137521389-137521411 CAGCATCCCTCACATCCCCTGGG - Intergenic
966862380 3:184237528-184237550 AAGCTTCTCTACTATCCCCTAGG + Intronic
969313847 4:6369958-6369980 CAGCATCCCTTCCATACTCTAGG + Intronic
970591691 4:17565579-17565601 CAGCAGCCCCACCATGCCCACGG + Intergenic
971135416 4:23863237-23863259 CAGCTTCCTCACCAGGCCCCTGG + Intronic
972011199 4:34184354-34184376 GAGCTTTCCTACCTTGCACTAGG + Intergenic
973333891 4:48936605-48936627 GATCTTTCCTCCCATGCCCTGGG - Intergenic
974025768 4:56732053-56732075 AAGCTTCCCTGCCACGCCCAAGG - Intergenic
975488154 4:74957931-74957953 CACATTCCCTACCATGCACCAGG - Intronic
975847108 4:78536315-78536337 AACCTTCCATACCATTCCCTAGG + Intronic
980576492 4:134688580-134688602 CAGCTTCCCCCCTTTGCCCTGGG + Intergenic
981312572 4:143311618-143311640 CAGCTTCCATGCCCTTCCCTTGG + Intergenic
983041180 4:162929633-162929655 CAACTTCCTTACCATGCCTATGG - Intergenic
985168929 4:187127646-187127668 CAGGTGCCCTCCCATGGCCTGGG - Intergenic
986242953 5:5977925-5977947 CAGTTTCCCATCCATGACCTTGG + Intergenic
986273451 5:6253723-6253745 CAGATTCCAGACCCTGCCCTGGG - Intergenic
986870769 5:12043087-12043109 CAGCTACCTTACCCTGCACTTGG + Intergenic
990169545 5:53032856-53032878 CAGCTTCCCCACCACTCCCTGGG + Intronic
990297069 5:54412962-54412984 CAGCTTCCCTGCTGCGCCCTGGG - Intergenic
991956520 5:72000321-72000343 CAGCTTCCCTTCCATTCCTGCGG - Intergenic
992129247 5:73674879-73674901 GAGCTTCCCTACCCTCCCCTGGG - Intronic
992351067 5:75929387-75929409 CAGCTTCCCCACCATGCCTTAGG - Intergenic
997210774 5:132075446-132075468 CAGCTGCCCTGCTCTGCCCTGGG + Intronic
998437845 5:142128316-142128338 CAGCCTCCCTGCCATGTCCCTGG - Intronic
999355644 5:150928284-150928306 CAGCTTCTCCACCAGGACCTGGG - Intergenic
999492388 5:152063929-152063951 CATCTTCCCTTCCCTGCCCTGGG - Intergenic
1001236632 5:170035310-170035332 CAACCTCCCTACCATTCCCAAGG + Intronic
1001668394 5:173453045-173453067 CTGCTTTCTCACCATGCCCTGGG + Intergenic
1002832317 6:834023-834045 CAGGTTCCCTCCCATGACGTGGG - Intergenic
1002869344 6:1152029-1152051 CAGCTTCCATCACATTCCCTAGG + Intergenic
1003936074 6:10976640-10976662 CAGCTTCCTCACCCTGACCTTGG + Intronic
1004537102 6:16513775-16513797 CTCCCTCCCTCCCATGCCCTAGG - Intronic
1006630711 6:35427850-35427872 CAGCCTCCCTTCCATGCCCCAGG + Exonic
1008483160 6:52007470-52007492 CAATTTCCCTACCTTGGCCTGGG - Intronic
1010041344 6:71388543-71388565 CAGCTTCCCTTCCACTCTCTAGG - Intergenic
1012330016 6:97973656-97973678 CACCTTCCCTGCCAAGCCATGGG + Intergenic
1015106133 6:129539251-129539273 CAGCTTCCCCAGCATACCCTTGG + Intergenic
1015300076 6:131643101-131643123 CAGCTTCCCTAGTATGACCTAGG + Intronic
1016974214 6:149791099-149791121 CAGTTTCCCCACCGGGCCCTGGG + Intronic
1016985041 6:149888802-149888824 CAGCCACTCTACCAGGCCCTGGG + Intronic
1018235036 6:161715824-161715846 AAGCTCCCCTACCATCCACTAGG + Intronic
1018235666 6:161721388-161721410 CAGCATCCCTGCCTTGCCCATGG + Intronic
1018317347 6:162569772-162569794 CAGCCTCCCTCCCAGGCTCTGGG - Intronic
1020465381 7:8472681-8472703 CAGCTTCCCTGACTTGGCCTGGG - Intronic
1021062931 7:16135931-16135953 CATTTTCCCTTCCATGTCCTTGG + Intronic
1023071590 7:36440185-36440207 CTGCTTCCCTCACTTGCCCTGGG - Intronic
1023117277 7:36874743-36874765 CTGCTTTCCAGCCATGCCCTGGG - Intronic
1023473116 7:40546714-40546736 CAGCTGGGCTACTATGCCCTGGG - Intronic
1023588729 7:41758773-41758795 CACCTTCCCTACCCTGCCACAGG - Intergenic
1023865061 7:44234570-44234592 CAGCTTCACCCCCACGCCCTGGG - Intronic
1023981910 7:45075314-45075336 CAGTTTCCCTGCCATGACCTAGG - Intronic
1027048687 7:75007916-75007938 CAGCTGCCCACCCGTGCCCTGGG - Intronic
1027266309 7:76496952-76496974 CAGCTTCCCCAGGAGGCCCTGGG - Intronic
1027317689 7:76995070-76995092 CAGCTTCCCCAGGAGGCCCTGGG - Intergenic
1029250503 7:99232887-99232909 CATCTTCCCCAGCATCCCCTAGG - Intergenic
1030895104 7:115049855-115049877 CAAATTCCCTACCATGTTCTAGG - Intergenic
1032093438 7:128923575-128923597 CAGCTGCCATTCCATGGCCTCGG - Intergenic
1035312225 7:157976591-157976613 CGGCTGCCCTACCAGACCCTGGG + Intronic
1035922691 8:3694618-3694640 CAGCCTCCCTCTCATGCCCAGGG - Intronic
1037258413 8:16980550-16980572 CAGCCTCCCTCCCATGCCATAGG + Intergenic
1038077586 8:24094115-24094137 CCCCTTCCCTACTATCCCCTGGG - Intergenic
1038684003 8:29698843-29698865 CAGTGTCCCTTCCAGGCCCTGGG + Intergenic
1039117860 8:34112634-34112656 CAGCTTCCCAGCCAGACCCTGGG - Intergenic
1040632407 8:49230586-49230608 CAGCTCCCCTGCCACACCCTTGG - Intergenic
1041009651 8:53529435-53529457 TGGCTTCCTTACCATGCCGTGGG - Intergenic
1044843329 8:96356613-96356635 CAGCTTCCCTGCCTCTCCCTTGG - Intergenic
1045775519 8:105797821-105797843 CAGCCTCTTTTCCATGCCCTGGG + Intronic
1046938594 8:119909207-119909229 CAGCTTCCCTACCTTGCCTCTGG + Intronic
1048189088 8:132272236-132272258 GACCTTCCCTACCCTGCCATTGG + Intronic
1048593728 8:135845110-135845132 CAGCTTCCCTATCCTGTCCCTGG - Intergenic
1048880819 8:138871165-138871187 CAGCCTCCCTGCCGTCCCCTGGG + Intronic
1053554551 9:39121970-39121992 CAGCTTCCTTCCCCTTCCCTTGG - Intronic
1053818643 9:41942091-41942113 CAGCTTCCTTCCCCTTCCCTTGG - Intronic
1054108907 9:61085749-61085771 CAGCTTCCTTCCCCTTCCCTTGG - Intergenic
1054611950 9:67245376-67245398 CAGCTTCCTTCCCCTTCCCTTGG + Intergenic
1057702870 9:97376335-97376357 CAGCTTCCCCTCCAAGCCCCAGG + Intronic
1058154665 9:101501923-101501945 CAGCGTCGCCACCAGGCCCTGGG + Intronic
1058674168 9:107386540-107386562 CAGTTTCCCTACTCAGCCCTTGG - Intergenic
1059006826 9:110411517-110411539 CAGCTTCTCTGCAATGCCCAGGG - Exonic
1059417036 9:114168653-114168675 AAGCCTCCCTACCAAGCCTTCGG + Exonic
1060230673 9:121822914-121822936 CAGCTGCCCTACGCTGCCCTGGG + Intronic
1060438954 9:123620277-123620299 AAGCTTCCCTACAAGGCTCTTGG + Intronic
1061211898 9:129198456-129198478 AAGCTTCCGTCCCCTGCCCTGGG - Intergenic
1061806089 9:133138434-133138456 CAGCTGCCCTCCCCTGCCCAGGG + Intronic
1062249193 9:135585847-135585869 CATCTTCCCTCCCAGGCCCCAGG + Intergenic
1186837567 X:13452780-13452802 CAGCTTCCTTCCCTTCCCCTCGG - Intergenic
1188257016 X:27975302-27975324 GAGCATTCCTACCATGCGCTTGG - Intergenic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1189489344 X:41457544-41457566 CAGCTTCTTCACCTTGCCCTTGG + Intronic
1189893685 X:45632221-45632243 CAGCCTCCCTCCCAGGCTCTGGG + Intergenic
1190329063 X:49224609-49224631 CAGGCACCCTACCAAGCCCTAGG - Intronic
1194165422 X:90508513-90508535 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1197593658 X:128441056-128441078 AAGCTGACCCACCATGCCCTGGG - Intergenic
1198498191 X:137215043-137215065 CACCTTCCCCACCCTGCCATGGG + Intergenic
1200511690 Y:4086323-4086345 CAGCAGGCCTACCAGGCCCTGGG - Intergenic