ID: 945507746

View in Genome Browser
Species Human (GRCh38)
Location 2:210662296-210662318
Sequence CAATCTTAATAGCCCTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945507746 Original CRISPR CAATCTTAATAGCCCTAGTG AGG Intronic
900068682 1:752318-752340 TAACCTTAATAGACCTAGTTGGG - Intergenic
903467676 1:23563514-23563536 CACTCTTAATAGCATTAGGGTGG + Intergenic
904563875 1:31415594-31415616 CAATATTAACTGCCCCAGTGGGG - Intronic
910577476 1:88781959-88781981 CAACGTTAATAGCCTTATTGAGG + Intronic
916782116 1:168044961-168044983 CAATCTTGATCGCTCTTGTGGGG + Exonic
922532079 1:226352417-226352439 CAATCATAATATCCCTCATGGGG + Intergenic
923013428 1:230107130-230107152 CAATCTTAAATGTCATAGTGAGG + Intronic
1065448054 10:25823276-25823298 CATTCTTATTAGCCCTATTGCGG - Intergenic
1066730139 10:38429608-38429630 CAGCCTTAATAGACCTAGTTGGG + Intergenic
1071874967 10:89835724-89835746 CAACATTATTAGCCATAGTGTGG + Intergenic
1078641032 11:13096689-13096711 CTATCTTATTAGTACTAGTGAGG - Intergenic
1089671721 11:120061716-120061738 CTAGCTTAGTAGCCCCAGTGTGG - Intergenic
1094308791 12:29053811-29053833 CAATCATAATAGCCCTAACCTGG + Intergenic
1105967246 13:25396148-25396170 CAATGTTAATAGACTGAGTGGGG + Intronic
1114237375 14:20834765-20834787 CCATCTTGATAATCCTAGTGGGG + Intergenic
1114735910 14:25043866-25043888 TATTCTTAATAGCCCTAAAGTGG - Intronic
1118056627 14:62085777-62085799 CATTCTAAATAGCCCTCATGTGG - Intronic
1120005473 14:79352057-79352079 CAACATCAATAGCCCTACTGGGG - Intronic
1122051744 14:99065569-99065591 CAAGTTTAAGAGCCCTGGTGAGG + Intergenic
1126927904 15:53611573-53611595 CCATCTAAATAGCCCCAGTCTGG - Intronic
1146601852 17:34224252-34224274 CAGTCTTAATTGCCGCAGTGTGG - Intergenic
1146752054 17:35390386-35390408 CTAGCTTGATAGCCCCAGTGGGG + Intergenic
1147350623 17:39840171-39840193 CACTCTAAATAGCCCAACTGAGG - Intronic
1167401216 19:49271378-49271400 CAATCTTTTTGGCACTAGTGTGG - Intergenic
929322489 2:40561421-40561443 CCCTCTTCAAAGCCCTAGTGGGG - Intronic
931041179 2:58302786-58302808 CAATCTGAATGCCCCTACTGTGG + Intergenic
932109768 2:68987312-68987334 CAATCCCAATAGGCCAAGTGCGG - Intergenic
933168257 2:79097702-79097724 CCATCTTAATAATCCCAGTGGGG + Intergenic
937099761 2:119259740-119259762 CAGCCTTAGTAGCCCCAGTGAGG - Intronic
941849960 2:170170433-170170455 CATTCTTAACAACCCTTGTGAGG + Intergenic
943112550 2:183623544-183623566 TACTCCTAATAGTCCTAGTGTGG - Intergenic
945507746 2:210662296-210662318 CAATCTTAATAGCCCTAGTGAGG + Intronic
948254904 2:236559908-236559930 CTATATTAATGGACCTAGTGTGG - Intergenic
1178222479 21:30675525-30675547 GATTTTGAATAGCCCTAGTGAGG - Intergenic
1179244426 21:39618857-39618879 CAATCTTTATAGCCTTAGAGTGG - Intronic
956014395 3:64866265-64866287 AAATCTTAATAGGCCTAATTTGG + Intergenic
956427150 3:69147934-69147956 GAATCTAAATAGGCCAAGTGCGG - Intergenic
960809736 3:121616194-121616216 TACTCCTAATAGCCCTAGTCAGG - Intronic
973051997 4:45608913-45608935 CCATCTTGATAGTCCTGGTGGGG - Intergenic
974449788 4:62038898-62038920 CAATCTTAAAAACACTAGTCTGG - Intronic
978976157 4:114876468-114876490 GACTCTTAATATCCCTTGTGTGG - Intronic
979404264 4:120289668-120289690 CAATCTTAGTAGATCTAGTTTGG - Intergenic
982530869 4:156541641-156541663 CAGTTTTAATAACCTTAGTGTGG + Intergenic
984869038 4:184310749-184310771 CATCCCTAATATCCCTAGTGTGG - Intergenic
988932514 5:36050474-36050496 CAATCTGCATATCACTAGTGAGG - Intronic
995492402 5:112707164-112707186 CTATCTTATGAGCCCTTGTGGGG + Intergenic
998496184 5:142591722-142591744 TCATCTTAAGAGCCCTGGTGTGG - Intergenic
999818337 5:155199885-155199907 CAATGTTAATAGACGAAGTGGGG - Intergenic
1002727304 5:181307974-181307996 TAACCTTAATAGACCTAGTTGGG + Intergenic
1004566722 6:16804901-16804923 AACTCATAATGGCCCTAGTGTGG + Intergenic
1008289522 6:49696736-49696758 AAATCTCAATAGACCAAGTGGGG + Intronic
1014489370 6:122043214-122043236 CAAACTAAATATCCCTAGTCAGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1035141056 7:156761684-156761706 AAAACTTAATAGGCCAAGTGCGG + Intronic
1041352634 8:56963934-56963956 CCATCTTAAAAGCCCTAGGGGGG - Exonic
1045384071 8:101654431-101654453 CAATCCAAATATCCCTAATGTGG - Intronic
1045699456 8:104849813-104849835 CTGTCTTGATAGCCCTGGTGTGG + Intronic
1052849888 9:33371536-33371558 TAATCTTCATAACCCTAATGAGG - Intergenic
1056671049 9:88627135-88627157 CAATCTCAGAAGCCCAAGTGTGG + Intergenic
1196622372 X:117838510-117838532 CAATTTTAATAGCCCCAGATGGG - Intergenic
1199270661 X:145879349-145879371 CAATCTTACTGGCGGTAGTGAGG - Intergenic