ID: 945509133

View in Genome Browser
Species Human (GRCh38)
Location 2:210678960-210678982
Sequence GTCCTTGCCCTTACAGTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945509133_945509138 18 Left 945509133 2:210678960-210678982 CCACCCACTGTAAGGGCAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 945509138 2:210679001-210679023 AAGAAAAAAGTCTCTCCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 357
945509133_945509139 19 Left 945509133 2:210678960-210678982 CCACCCACTGTAAGGGCAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 945509139 2:210679002-210679024 AGAAAAAAGTCTCTCCCCAAGGG 0: 1
1: 0
2: 2
3: 35
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945509133 Original CRISPR GTCCTTGCCCTTACAGTGGG TGG (reversed) Exonic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901978451 1:13014160-13014182 GTCCATGGACTGACAGTGGGAGG - Intronic
902003632 1:13214778-13214800 GTCCATGGACTGACAGTGGGAGG + Intergenic
902022857 1:13360517-13360539 GTCCATGGACTGACAGTGGGAGG + Intergenic
905946101 1:41902467-41902489 CACCTTGCCCTGGCAGTGGGGGG - Intronic
906493192 1:46284083-46284105 GTCCTTGCCAGTGCAGTGGTAGG + Intronic
907287290 1:53390025-53390047 GTCCATGCCCTCACACTGGCTGG - Intergenic
910220310 1:84883293-84883315 ATCCTTTCCCTCACACTGGGTGG + Intronic
912344966 1:108955671-108955693 GTGCTGGCCCCTACAGAGGGTGG - Intronic
912459322 1:109820476-109820498 GTCCCTGCCCTTTGAGGGGGTGG + Intergenic
915356286 1:155256785-155256807 ATCCTTCCCTTTACAGTGGCTGG - Exonic
917137606 1:171802726-171802748 CTCCTTGCCCTTTGAGTGGATGG + Intronic
918210773 1:182349187-182349209 CTCTTTGCCATTCCAGTGGGAGG - Intergenic
924112191 1:240711224-240711246 GTGCCTGCCCTTACAGTGCGAGG - Intergenic
924509101 1:244713550-244713572 GTGGTTACCCTTCCAGTGGGGGG - Intergenic
1067817939 10:49497048-49497070 GTCCCTGCCCTTCAACTGGGTGG + Intronic
1070396567 10:76016310-76016332 CTCATTGCCCTTACATTGGGTGG + Intronic
1071551018 10:86566226-86566248 GTCCTCGCCCTTACTCTGTGAGG - Intergenic
1072756705 10:98026295-98026317 GTCCTTACCATTACAATGAGAGG + Intronic
1074740180 10:116478929-116478951 GTCCTTGCCCAAACAGTAGTAGG - Intergenic
1074882282 10:117668326-117668348 GACCTTCCCCACACAGTGGGAGG - Intergenic
1076227238 10:128788690-128788712 GTTCTTGCCCATGCAGTCGGAGG + Intergenic
1076891874 10:133288669-133288691 GACCTGGCACTCACAGTGGGTGG - Intronic
1080666929 11:34344409-34344431 TTCTTTGCCCTTCCAGAGGGTGG - Intronic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1084320232 11:68369527-68369549 TGCCTTGCCCTAACAGTGGAAGG + Intronic
1085633425 11:78139102-78139124 GTCCTTGCCCTCGAAGTTGGTGG - Intronic
1088887572 11:114019844-114019866 GGCCTTGGCCACACAGTGGGAGG - Intergenic
1090253572 11:125267439-125267461 TTCCTTGCCCTTTCAGTAAGAGG + Intronic
1094414942 12:30206281-30206303 GTACATGCCTTTACAGTGTGTGG - Intergenic
1096981914 12:55732996-55733018 CTCCTTACCCTCCCAGTGGGGGG - Intergenic
1098919668 12:76292180-76292202 GTCCTTGCCCTCACTCTGTGAGG + Intergenic
1101592324 12:106135876-106135898 GTTCTTGCCCATACAGTGCCTGG - Intronic
1106923564 13:34589843-34589865 GTGCTGGCCTTTACAGTGGGTGG - Intergenic
1111966389 13:94866307-94866329 GCTCCTGCCCTTGCAGTGGGAGG + Intergenic
1119009721 14:70972210-70972232 GTCTTTCCCCTTTCAGTTGGCGG - Intronic
1119395567 14:74323736-74323758 TTCCCTGACCTTCCAGTGGGAGG - Intronic
1122865216 14:104600857-104600879 GGCCTTGCCCTCACACTGGCAGG + Intronic
1122885825 14:104709879-104709901 GTCCTTCCCCTCAAAGTGTGGGG + Intronic
1124171104 15:27374801-27374823 GTCCTGACACTTCCAGTGGGCGG + Intronic
1127367316 15:58303372-58303394 ATCCTTGCTGGTACAGTGGGAGG + Intronic
1129382425 15:75176675-75176697 TTCCCTGCCCTTACAGAGAGAGG - Intergenic
1132577135 16:669287-669309 GTCCCTGCACTGGCAGTGGGCGG + Intronic
1134329210 16:13235228-13235250 GTCCCAGCCCTTAAAGTTGGTGG - Exonic
1134677801 16:16102749-16102771 GACCCTGCCCTGCCAGTGGGAGG + Intronic
1137244373 16:46690109-46690131 GTCCTCGCCCTTACAGACAGCGG - Intronic
1137438783 16:48481197-48481219 ATACTTGTCTTTACAGTGGGTGG - Intergenic
1138976486 16:62214254-62214276 TTTCTTGCCCTTCCAGTGTGTGG - Intergenic
1143480619 17:7225779-7225801 GTGCTTGCTCTTACAGTGCCTGG - Exonic
1144022873 17:11252443-11252465 GCCCTTGCTGTTTCAGTGGGAGG + Intronic
1145755341 17:27386139-27386161 GTCCTTCCCATTCCTGTGGGTGG + Intergenic
1147872049 17:43594321-43594343 GTCCCAGCCCTCCCAGTGGGAGG - Intergenic
1148617670 17:49013390-49013412 GTTCCTGGCCTCACAGTGGGAGG + Intronic
1151876742 17:76871160-76871182 GTCCTTGTCCTCAGACTGGGAGG + Intronic
1165075757 19:33279079-33279101 GTCATTCCCCTCACAGTGTGAGG + Intergenic
928346758 2:30505271-30505293 GTCCTTGCCTTCACAGCTGGAGG - Intronic
932094089 2:68831685-68831707 ATCCTTGCCCTCACATAGGGAGG + Intergenic
933001610 2:76931592-76931614 TTCCTTGCCCTCAAAGTTGGAGG + Intronic
936895794 2:117426221-117426243 GTACTTTCCCATACACTGGGAGG - Intergenic
938779317 2:134570765-134570787 GTCCTAGCCCTTACAGTATCAGG - Intronic
945509133 2:210678960-210678982 GTCCTTGCCCTTACAGTGGGTGG - Exonic
947746270 2:232508811-232508833 GTCCTTGGCCTTAGTGTGGGCGG + Intergenic
1171212576 20:23328077-23328099 GTCCTTGCCCTTCCAGATGCAGG - Intergenic
1171481468 20:25458608-25458630 TTCCTTGCCCTTGCAGGTGGGGG - Intronic
1173073267 20:39790880-39790902 CACCTTGCCCTTACAGTGCTGGG - Intergenic
1175985962 20:62764322-62764344 GACCATGCCCTTAGGGTGGGTGG - Intergenic
1176310878 21:5148187-5148209 GTACTTGCCCTTGATGTGGGCGG - Intronic
1178399002 21:32267165-32267187 GGCCTTGCCATCACAGTGAGAGG - Intergenic
1179488812 21:41727472-41727494 GTCCTAACCCTCCCAGTGGGTGG + Intergenic
1179846177 21:44113848-44113870 GTACTTGCCCTTGATGTGGGCGG + Intronic
1180158761 21:45989920-45989942 GTCCTTGTCCTTCCAGATGGAGG - Intronic
1180245585 21:46545438-46545460 GGCCTTGCCCTCACTCTGGGAGG - Intronic
1181590446 22:23881482-23881504 GTACTTGCCCCTTTAGTGGGAGG + Intronic
1182657522 22:31902592-31902614 CTCCTTCCACTAACAGTGGGTGG + Intronic
949707662 3:6837584-6837606 GTCCTTTGCCTTCCAATGGGCGG - Intronic
952533955 3:34290739-34290761 TTCCTTCCCCTTACAGCGAGGGG + Intergenic
956521122 3:70105455-70105477 GTCTTTGCACTTTCAGAGGGAGG - Intergenic
958138116 3:89523127-89523149 TTTCTTGTACTTACAGTGGGTGG + Intergenic
961734760 3:128994331-128994353 GTCCTTGCCCGTACGATGGGAGG + Intronic
965781117 3:172287119-172287141 GTCCATGCCCATCAAGTGGGAGG + Intronic
968153943 3:196362804-196362826 GTCCTTGCTCTTAAAGTAGAAGG - Intronic
968697632 4:2040850-2040872 GTCCTGACCCTAAGAGTGGGTGG - Intronic
969535577 4:7754638-7754660 GTCTGGGCCTTTACAGTGGGTGG - Intergenic
976131091 4:81884704-81884726 GTACTAGCCCTTATAGTGGAAGG + Intronic
980623785 4:135345046-135345068 GTAGTTGCTCTTCCAGTGGGTGG - Intergenic
988430539 5:31114091-31114113 TTCCTTCCCCTTACAGATGGTGG + Intergenic
998177575 5:139911348-139911370 GTCCTTCCCCTCTCACTGGGAGG - Intronic
1006764578 6:36493498-36493520 GCCCTTGGCCTTACTGTGAGGGG + Intergenic
1010940773 6:81915176-81915198 GTCCTGACCCTGACAGTGGGGGG - Intergenic
1028590138 7:92484767-92484789 GTCCTTGCCCTCACTCTGTGAGG - Intergenic
1030193430 7:106831582-106831604 GTTCTTGTCCTTACCTTGGGTGG - Intergenic
1034745671 7:153521787-153521809 GATTGTGCCCTTACAGTGGGTGG + Intergenic
1035344421 7:158188703-158188725 GGCCTTCCCCCTACAGGGGGCGG - Intronic
1043364573 8:79517776-79517798 GTCCTTGACCTAACATTGAGTGG + Intergenic
1049357130 8:142194494-142194516 GTCCTTGGCCTGACACTCGGAGG - Intergenic
1057503180 9:95611784-95611806 TTCCTTGCCACTCCAGTGGGGGG - Intergenic
1057903107 9:98964717-98964739 GGCCTGGATCTTACAGTGGGGGG + Intronic
1061123145 9:128656567-128656589 GTCCGTGCCCTCGCAGTGGAGGG - Exonic
1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG + Intergenic
1187245987 X:17553272-17553294 GGCCCTGCCCTCCCAGTGGGAGG + Intronic
1188046770 X:25434291-25434313 GTCCTTGCATTTAGAGTGTGTGG + Intergenic
1188616838 X:32167849-32167871 CTCCTTGTCCCCACAGTGGGAGG + Intronic
1197377679 X:125701829-125701851 GCCTTTGCCCATACAGTAGGTGG + Intergenic
1199229748 X:145423245-145423267 GTGCTTGGCTTTGCAGTGGGTGG + Intergenic
1200409519 Y:2847467-2847489 GTGATTGCCATTACAGTGGATGG + Intronic