ID: 945512119

View in Genome Browser
Species Human (GRCh38)
Location 2:210715375-210715397
Sequence GCTTCTTCCTCCAAGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945512114_945512119 -8 Left 945512114 2:210715360-210715382 CCTTTACATTCTGAGGCTTCTTC No data
Right 945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945512119 Original CRISPR GCTTCTTCCTCCAAGGGGTT GGG Intergenic
No off target data available for this crispr