ID: 945516401

View in Genome Browser
Species Human (GRCh38)
Location 2:210768074-210768096
Sequence GCTCTTGGAGTTGCATACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945516396_945516401 -4 Left 945516396 2:210768055-210768077 CCAGAAGCCTTCAAATGCTGCTC No data
Right 945516401 2:210768074-210768096 GCTCTTGGAGTTGCATACTGGGG No data
945516395_945516401 1 Left 945516395 2:210768050-210768072 CCAGGCCAGAAGCCTTCAAATGC No data
Right 945516401 2:210768074-210768096 GCTCTTGGAGTTGCATACTGGGG No data
945516393_945516401 12 Left 945516393 2:210768039-210768061 CCCTTTCTAAGCCAGGCCAGAAG No data
Right 945516401 2:210768074-210768096 GCTCTTGGAGTTGCATACTGGGG No data
945516394_945516401 11 Left 945516394 2:210768040-210768062 CCTTTCTAAGCCAGGCCAGAAGC No data
Right 945516401 2:210768074-210768096 GCTCTTGGAGTTGCATACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945516401 Original CRISPR GCTCTTGGAGTTGCATACTG GGG Intergenic
No off target data available for this crispr