ID: 945516774

View in Genome Browser
Species Human (GRCh38)
Location 2:210772334-210772356
Sequence GCTGGATTCAATGGTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945516774_945516779 6 Left 945516774 2:210772334-210772356 CCAGAAATACCATTGAATCCAGC No data
Right 945516779 2:210772363-210772385 ATTACTGAGTATATACCCAAAGG 0: 663
1: 19624
2: 11708
3: 7233
4: 6010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945516774 Original CRISPR GCTGGATTCAATGGTATTTC TGG (reversed) Intergenic
No off target data available for this crispr