ID: 945516779

View in Genome Browser
Species Human (GRCh38)
Location 2:210772363-210772385
Sequence ATTACTGAGTATATACCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45238
Summary {0: 663, 1: 19624, 2: 11708, 3: 7233, 4: 6010}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945516775_945516779 -3 Left 945516775 2:210772343-210772365 CCATTGAATCCAGCAATCCCATT No data
Right 945516779 2:210772363-210772385 ATTACTGAGTATATACCCAAAGG 0: 663
1: 19624
2: 11708
3: 7233
4: 6010
945516774_945516779 6 Left 945516774 2:210772334-210772356 CCAGAAATACCATTGAATCCAGC No data
Right 945516779 2:210772363-210772385 ATTACTGAGTATATACCCAAAGG 0: 663
1: 19624
2: 11708
3: 7233
4: 6010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945516779 Original CRISPR ATTACTGAGTATATACCCAA AGG Intergenic
Too many off-targets to display for this crispr