ID: 945520712

View in Genome Browser
Species Human (GRCh38)
Location 2:210823964-210823986
Sequence CAGAACACTGAGAAAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945520703_945520712 25 Left 945520703 2:210823916-210823938 CCTAGGTATACTTTACATCCATT No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520705_945520712 1 Left 945520705 2:210823940-210823962 CCCCCAGAGTTGAAGCCACCTCC No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520704_945520712 7 Left 945520704 2:210823934-210823956 CCATTTCCCCCAGAGTTGAAGCC No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520702_945520712 26 Left 945520702 2:210823915-210823937 CCCTAGGTATACTTTACATCCAT No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520706_945520712 0 Left 945520706 2:210823941-210823963 CCCCAGAGTTGAAGCCACCTCCT No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520707_945520712 -1 Left 945520707 2:210823942-210823964 CCCAGAGTTGAAGCCACCTCCTC No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data
945520708_945520712 -2 Left 945520708 2:210823943-210823965 CCAGAGTTGAAGCCACCTCCTCA No data
Right 945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945520712 Original CRISPR CAGAACACTGAGAAAGAGTC TGG Intergenic
No off target data available for this crispr