ID: 945524748

View in Genome Browser
Species Human (GRCh38)
Location 2:210874389-210874411
Sequence ATCTGATGGTACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5071
Summary {0: 2, 1: 50, 2: 562, 3: 1583, 4: 2874}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945524748_945524755 17 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524755 2:210874429-210874451 CCTGCTTCCTGGGTCATAGATGG No data
945524748_945524757 28 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524757 2:210874440-210874462 GGTCATAGATGGCTGACCTCTGG No data
945524748_945524752 6 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524752 2:210874418-210874440 TCTAGTAAGGGCCTGCTTCCTGG No data
945524748_945524753 7 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524753 2:210874419-210874441 CTAGTAAGGGCCTGCTTCCTGGG No data
945524748_945524751 -6 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524751 2:210874406-210874428 TCAGATTCAGAATCTAGTAAGGG No data
945524748_945524750 -7 Left 945524748 2:210874389-210874411 CCAAGATCAAGGTACCATCAGAT 0: 2
1: 50
2: 562
3: 1583
4: 2874
Right 945524750 2:210874405-210874427 ATCAGATTCAGAATCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945524748 Original CRISPR ATCTGATGGTACCTTGATCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr