ID: 945524761

View in Genome Browser
Species Human (GRCh38)
Location 2:210874463-210874485
Sequence CTGTGTTATCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945524754_945524761 11 Left 945524754 2:210874429-210874451 CCTGCTTCCTGGGTCATAGATGG No data
Right 945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG No data
945524756_945524761 4 Left 945524756 2:210874436-210874458 CCTGGGTCATAGATGGCTGACCT No data
Right 945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945524761 Original CRISPR CTGTGTTATCAGATGGTGGA AGG Intergenic
No off target data available for this crispr