ID: 945527989

View in Genome Browser
Species Human (GRCh38)
Location 2:210912697-210912719
Sequence CTGTGTTGTCGGAGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945527979_945527989 19 Left 945527979 2:210912655-210912677 CCTACCAAAATCTCAGCTTGAAT No data
Right 945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG No data
945527980_945527989 15 Left 945527980 2:210912659-210912681 CCAAAATCTCAGCTTGAATTGTG No data
Right 945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945527989 Original CRISPR CTGTGTTGTCGGAGGGACCC AGG Intergenic
No off target data available for this crispr