ID: 945530267

View in Genome Browser
Species Human (GRCh38)
Location 2:210944727-210944749
Sequence GGGTAGGGCTAGAATGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945530262_945530267 1 Left 945530262 2:210944703-210944725 CCAGTAGTCTACATAAAAAATAA No data
Right 945530267 2:210944727-210944749 GGGTAGGGCTAGAATGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945530267 Original CRISPR GGGTAGGGCTAGAATGATAG TGG Intergenic
No off target data available for this crispr