ID: 945537789

View in Genome Browser
Species Human (GRCh38)
Location 2:211040627-211040649
Sequence TCTCACGTACTGTTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945537787_945537789 -4 Left 945537787 2:211040608-211040630 CCTGTAGGAGGTAGCTTAATCTC No data
Right 945537789 2:211040627-211040649 TCTCACGTACTGTTGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945537789 Original CRISPR TCTCACGTACTGTTGGAACT TGG Intergenic
No off target data available for this crispr