ID: 945539139

View in Genome Browser
Species Human (GRCh38)
Location 2:211061815-211061837
Sequence AGTAATTACCAGGATATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945539139_945539141 19 Left 945539139 2:211061815-211061837 CCTGCTATATCCTGGTAATTACT No data
Right 945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945539139 Original CRISPR AGTAATTACCAGGATATAGC AGG (reversed) Intergenic
No off target data available for this crispr