ID: 945539141

View in Genome Browser
Species Human (GRCh38)
Location 2:211061857-211061879
Sequence TTCACAAACCATGCTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945539137_945539141 21 Left 945539137 2:211061813-211061835 CCCCTGCTATATCCTGGTAATTA No data
Right 945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG No data
945539139_945539141 19 Left 945539139 2:211061815-211061837 CCTGCTATATCCTGGTAATTACT No data
Right 945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG No data
945539140_945539141 9 Left 945539140 2:211061825-211061847 CCTGGTAATTACTGATTCTTCTC No data
Right 945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG No data
945539138_945539141 20 Left 945539138 2:211061814-211061836 CCCTGCTATATCCTGGTAATTAC No data
Right 945539141 2:211061857-211061879 TTCACAAACCATGCTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945539141 Original CRISPR TTCACAAACCATGCTTTTAT TGG Intergenic
No off target data available for this crispr