ID: 945541117

View in Genome Browser
Species Human (GRCh38)
Location 2:211087947-211087969
Sequence TATTGTCTCTGATTGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945541117_945541120 22 Left 945541117 2:211087947-211087969 CCTTAATTCAATCAGAGACAATA No data
Right 945541120 2:211087992-211088014 ACCTTCCAATTCCTTAGCTTGGG No data
945541117_945541119 21 Left 945541117 2:211087947-211087969 CCTTAATTCAATCAGAGACAATA No data
Right 945541119 2:211087991-211088013 CACCTTCCAATTCCTTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945541117 Original CRISPR TATTGTCTCTGATTGAATTA AGG (reversed) Intergenic
No off target data available for this crispr