ID: 945541119

View in Genome Browser
Species Human (GRCh38)
Location 2:211087991-211088013
Sequence CACCTTCCAATTCCTTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945541117_945541119 21 Left 945541117 2:211087947-211087969 CCTTAATTCAATCAGAGACAATA No data
Right 945541119 2:211087991-211088013 CACCTTCCAATTCCTTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945541119 Original CRISPR CACCTTCCAATTCCTTAGCT TGG Intergenic
No off target data available for this crispr