ID: 945543350

View in Genome Browser
Species Human (GRCh38)
Location 2:211117568-211117590
Sequence AGAGATCGATCTAGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945543350_945543353 6 Left 945543350 2:211117568-211117590 CCAACAACACTAGATCGATCTCT No data
Right 945543353 2:211117597-211117619 GGTTCAAATGCAAAGAAAAAGGG No data
945543350_945543352 5 Left 945543350 2:211117568-211117590 CCAACAACACTAGATCGATCTCT No data
Right 945543352 2:211117596-211117618 AGGTTCAAATGCAAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945543350 Original CRISPR AGAGATCGATCTAGTGTTGT TGG (reversed) Intergenic