ID: 945554708

View in Genome Browser
Species Human (GRCh38)
Location 2:211263805-211263827
Sequence GGTTCCACACAGATGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945554708_945554713 -5 Left 945554708 2:211263805-211263827 CCGTGTCCCATCTGTGTGGAACC No data
Right 945554713 2:211263823-211263845 GAACCCCACTGGAAATCGGATGG No data
945554708_945554717 9 Left 945554708 2:211263805-211263827 CCGTGTCCCATCTGTGTGGAACC No data
Right 945554717 2:211263837-211263859 ATCGGATGGTCCAACTTGCCTGG No data
945554708_945554712 -9 Left 945554708 2:211263805-211263827 CCGTGTCCCATCTGTGTGGAACC No data
Right 945554712 2:211263819-211263841 TGTGGAACCCCACTGGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945554708 Original CRISPR GGTTCCACACAGATGGGACA CGG (reversed) Intergenic
No off target data available for this crispr