ID: 945555839

View in Genome Browser
Species Human (GRCh38)
Location 2:211274827-211274849
Sequence TTCTGGTATAAGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945555839_945555849 21 Left 945555839 2:211274827-211274849 CCTCCTCCCCTCTTATACCAGAA No data
Right 945555849 2:211274871-211274893 AGACCCTTATATGCCTTGAGGGG No data
945555839_945555850 22 Left 945555839 2:211274827-211274849 CCTCCTCCCCTCTTATACCAGAA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555839_945555848 20 Left 945555839 2:211274827-211274849 CCTCCTCCCCTCTTATACCAGAA No data
Right 945555848 2:211274870-211274892 GAGACCCTTATATGCCTTGAGGG No data
945555839_945555847 19 Left 945555839 2:211274827-211274849 CCTCCTCCCCTCTTATACCAGAA No data
Right 945555847 2:211274869-211274891 AGAGACCCTTATATGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945555839 Original CRISPR TTCTGGTATAAGAGGGGAGG AGG (reversed) Intergenic