ID: 945555840

View in Genome Browser
Species Human (GRCh38)
Location 2:211274830-211274852
Sequence CCTTTCTGGTATAAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945555840_945555847 16 Left 945555840 2:211274830-211274852 CCTCCCCTCTTATACCAGAAAGG No data
Right 945555847 2:211274869-211274891 AGAGACCCTTATATGCCTTGAGG No data
945555840_945555849 18 Left 945555840 2:211274830-211274852 CCTCCCCTCTTATACCAGAAAGG No data
Right 945555849 2:211274871-211274893 AGACCCTTATATGCCTTGAGGGG No data
945555840_945555848 17 Left 945555840 2:211274830-211274852 CCTCCCCTCTTATACCAGAAAGG No data
Right 945555848 2:211274870-211274892 GAGACCCTTATATGCCTTGAGGG No data
945555840_945555850 19 Left 945555840 2:211274830-211274852 CCTCCCCTCTTATACCAGAAAGG No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945555840 Original CRISPR CCTTTCTGGTATAAGAGGGG AGG (reversed) Intergenic