ID: 945555844

View in Genome Browser
Species Human (GRCh38)
Location 2:211274835-211274857
Sequence TTTGTCCTTTCTGGTATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945555844_945555848 12 Left 945555844 2:211274835-211274857 CCTCTTATACCAGAAAGGACAAA No data
Right 945555848 2:211274870-211274892 GAGACCCTTATATGCCTTGAGGG No data
945555844_945555850 14 Left 945555844 2:211274835-211274857 CCTCTTATACCAGAAAGGACAAA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555844_945555849 13 Left 945555844 2:211274835-211274857 CCTCTTATACCAGAAAGGACAAA No data
Right 945555849 2:211274871-211274893 AGACCCTTATATGCCTTGAGGGG No data
945555844_945555847 11 Left 945555844 2:211274835-211274857 CCTCTTATACCAGAAAGGACAAA No data
Right 945555847 2:211274869-211274891 AGAGACCCTTATATGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945555844 Original CRISPR TTTGTCCTTTCTGGTATAAG AGG (reversed) Intergenic