ID: 945555850

View in Genome Browser
Species Human (GRCh38)
Location 2:211274872-211274894
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945555840_945555850 19 Left 945555840 2:211274830-211274852 CCTCCCCTCTTATACCAGAAAGG No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555839_945555850 22 Left 945555839 2:211274827-211274849 CCTCCTCCCCTCTTATACCAGAA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555844_945555850 14 Left 945555844 2:211274835-211274857 CCTCTTATACCAGAAAGGACAAA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555843_945555850 15 Left 945555843 2:211274834-211274856 CCCTCTTATACCAGAAAGGACAA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555838_945555850 23 Left 945555838 2:211274826-211274848 CCCTCCTCCCCTCTTATACCAGA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555842_945555850 16 Left 945555842 2:211274833-211274855 CCCCTCTTATACCAGAAAGGACA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data
945555845_945555850 5 Left 945555845 2:211274844-211274866 CCAGAAAGGACAAAAATTAATCA No data
Right 945555850 2:211274872-211274894 GACCCTTATATGCCTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr