ID: 945565919

View in Genome Browser
Species Human (GRCh38)
Location 2:211399168-211399190
Sequence ATTCACATGGGGCATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945565919 Original CRISPR ATTCACATGGGGCATATAAT GGG (reversed) Intronic
901294396 1:8149290-8149312 ATCTTCATGGGGCATATATTGGG - Intergenic
902193091 1:14777487-14777509 GGTCGCATGGGGCATAGAATTGG - Intronic
903327825 1:22581391-22581413 GTTCACCTGGGACAAATAATTGG - Intronic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
905238648 1:36567922-36567944 ATCCAGATGGGGCTTAGAATGGG - Intergenic
910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG + Exonic
910709100 1:90160179-90160201 AGTCACTTGGGGCATAGAACAGG + Intergenic
916128643 1:161592712-161592734 ACTCACTTGGGTCATATAGTTGG - Intronic
916138561 1:161674543-161674565 ACTCACTTGGGTCATATAGTTGG - Intronic
916230730 1:162538897-162538919 ATACACATGCCCCATATAATAGG + Intergenic
917668533 1:177249353-177249375 ATTCACATTGCACATATAAAGGG - Intronic
917922252 1:179760294-179760316 TTACACATTGGGCATACAATGGG - Intronic
918085292 1:181239812-181239834 ACACACCTGGGGCATATAAGAGG - Intergenic
920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG + Intronic
921754978 1:218844713-218844735 AATCACATGCTGCATATATTGGG - Intergenic
922626419 1:227049521-227049543 TTTCACATGGGGCTTTTGATTGG - Intronic
1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG + Intergenic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1077667773 11:4129512-4129534 AGTTACATCGGGCATATAAATGG + Intronic
1079889904 11:26038762-26038784 CTTCATAAGAGGCATATAATAGG + Intergenic
1081305197 11:41503239-41503261 ATTCACATGAAGCAAATAGTAGG - Intergenic
1084444079 11:69193341-69193363 AGCCAAATGGGGCATTTAATTGG + Intergenic
1095153598 12:38825088-38825110 ATTCACACTGGGGAAATAATAGG - Intronic
1097249832 12:57626471-57626493 ATTCTCATGGGGCAGGAAATGGG - Exonic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1100015361 12:90003900-90003922 ATTCATATGGGCAATTTAATTGG + Intergenic
1100734357 12:97510914-97510936 ATTCACATGGAGTCCATAATTGG + Intergenic
1110101094 13:71603823-71603845 ATTTACATGGAGCATAATATCGG - Intronic
1112954270 13:105039922-105039944 ATTGACATGGGCCTTATCATTGG - Intergenic
1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG + Intergenic
1117271966 14:54153878-54153900 AGTCACATGGTACATTTAATTGG - Intergenic
1118229472 14:63934409-63934431 GTTCAAATGGAGCACATAATCGG - Intronic
1121906277 14:97749307-97749329 CTTAACATGATGCATATAATAGG - Exonic
1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG + Intronic
1140636130 16:76916107-76916129 AGTCAGATGGGCCAAATAATTGG - Intergenic
1147051386 17:37797223-37797245 ATCCCAATGGAGCATATAATGGG - Intergenic
1148625277 17:49064594-49064616 ATTCACATGGGTCATGAAGTGGG - Intergenic
1151763468 17:76120590-76120612 AGTGACATGGCGCATATAAAAGG + Intronic
1153936357 18:9928124-9928146 ATTCATATTGGGCAAATGATAGG + Intronic
1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG + Intergenic
1158983059 18:62784129-62784151 CTTCACATGGGGCAGACAGTGGG + Intronic
1159675891 18:71283970-71283992 ATTTACATAGGGCATAAAAATGG + Intergenic
928635530 2:33241758-33241780 TTTTACTTGGGACATATAATAGG + Intronic
929118520 2:38465032-38465054 ATTTACATGGGGCATTTACATGG - Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
931936750 2:67206710-67206732 TGACACATGGGTCATATAATTGG - Intergenic
932575034 2:72958139-72958161 GTTCCTCTGGGGCATATAATGGG - Intronic
934116182 2:88796888-88796910 ATTCAAATGGATCAAATAATGGG - Intergenic
934626974 2:95867954-95867976 ATTCAAATGGATCAAATAATTGG + Intronic
934806585 2:97233335-97233357 ATTCAAATGGATCAAATAATTGG - Intronic
934830924 2:97523840-97523862 ATTCAAATGGATCAAATAATTGG + Intronic
935751988 2:106243663-106243685 ATCCACATGTTGCACATAATAGG + Intergenic
935912398 2:107911210-107911232 ATCCACATGTTGCACATAATAGG + Intergenic
938552789 2:132396087-132396109 ATATAGATGGGGCATATAGTGGG - Intergenic
945541691 2:211095680-211095702 ATACAAATTGGGCATATTATTGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG + Intergenic
1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG + Intergenic
1184909899 22:47524160-47524182 ATACCCATGGGGAATATGATTGG - Intergenic
949774093 3:7611931-7611953 ATTCTCATGAAGAATATAATAGG + Intronic
951073967 3:18366805-18366827 ATTTACAGGTGGCATATAATGGG - Intronic
955152054 3:56377086-56377108 ATTAACATTGGGCCTCTAATCGG - Intronic
956096300 3:65720347-65720369 ATGCCCATGGGGCATACACTGGG - Intronic
956493291 3:69797145-69797167 ATTCACATGTGGCATTAAATTGG - Intronic
957414946 3:79889877-79889899 ATTGACCTTGGGTATATAATGGG - Intergenic
957485049 3:80850116-80850138 CTTGACATGGGGCAGATTATGGG - Intergenic
957514714 3:81235154-81235176 ATTCACATGTGGCAGAGAAGAGG - Intergenic
965945375 3:174234025-174234047 ATTCACATGGAACTTAAAATAGG - Intronic
966907263 3:184536095-184536117 ATTCACATGAGGCCCCTAATGGG + Intronic
967581457 3:191160633-191160655 ATTAACATGTGCCATATACTGGG - Intergenic
969336599 4:6513992-6514014 ATACAGATGGGGTGTATAATTGG + Intronic
972079945 4:35138191-35138213 TTTCACATGTGGCAATTAATGGG - Intergenic
978029168 4:103917160-103917182 ATTCACATGGGGAATAGAGAAGG - Intergenic
978487577 4:109273031-109273053 TTTTTCATGGGGCATATATTGGG - Intronic
981528524 4:145731472-145731494 ATTAATATGGGGCACATATTTGG + Intronic
981886691 4:149683413-149683435 ATTCACATTTGGCACATAGTAGG + Intergenic
983328523 4:166291728-166291750 ATTGAGATGGGGAATATAAGAGG + Intergenic
983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG + Intronic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
1003190396 6:3869545-3869567 TTTCACCTGGGCCAGATAATGGG + Intergenic
1004201298 6:13550395-13550417 ATTCACAGGGGAAATACAATAGG - Intergenic
1006203112 6:32314442-32314464 TTGCACATGGGCCATATAATTGG - Intronic
1006736297 6:36275747-36275769 TTTCACATGGGGCAAAGAAAGGG - Intronic
1010938918 6:81892727-81892749 AGTCTCATGGGGCTTATAAAAGG - Intergenic
1011463441 6:87630487-87630509 ATTAACACCGGGCACATAATAGG - Intronic
1012054697 6:94391640-94391662 CTTCACTTGAGGCACATAATGGG - Intergenic
1013728024 6:113124920-113124942 ATTCACATGTTGCATATTAGTGG - Intergenic
1014430364 6:121363328-121363350 ATTTACATGGGGTAAATATTTGG - Intergenic
1015517975 6:134103075-134103097 ATTGGCTGGGGGCATATAATTGG + Intergenic
1018529034 6:164743500-164743522 TTTCACATTGGGCATGTTATGGG - Intergenic
1018628345 6:165801897-165801919 ATCCACCTTTGGCATATAATGGG - Intronic
1034144347 7:148855246-148855268 ACACACATGGGGCAAAGAATTGG + Intronic
1034405384 7:150899343-150899365 ATGGACATGGGACATATATTTGG - Intergenic
1036384960 8:8270779-8270801 ATTCCCATAGGGGATAGAATCGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1039624801 8:39037929-39037951 ATTCACATGGGGAAGACTATGGG - Intronic
1040547870 8:48414582-48414604 ATTCACTTAGGTCATCTAATTGG - Intergenic
1041345926 8:56898054-56898076 AGACTCATGGGGGATATAATTGG - Intergenic
1042788366 8:72575051-72575073 TTTCCCATGGGGCATATACCTGG + Intronic
1044203530 8:89464511-89464533 AATCACATGAGGCATGTATTAGG + Intergenic
1046285180 8:112084443-112084465 ATTTCCATGGGACATAAAATAGG + Intergenic
1046363886 8:113200042-113200064 ATTCCCATGAGGCATCTAAATGG - Intronic
1046544938 8:115638070-115638092 ATTTACATGGGGTGTATAGTGGG - Intronic
1047330358 8:123881363-123881385 ATTCACCTATGGCAAATAATGGG + Intronic
1047820223 8:128511166-128511188 ATTCACATGGTGCTGAAAATGGG - Intergenic
1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG + Intronic
1048712286 8:137225757-137225779 AGTCACATGCTGCATATGATGGG + Intergenic
1052569561 9:30201926-30201948 TTTCACATTTGCCATATAATAGG - Intergenic
1053551629 9:39085823-39085845 CTTCTCATGGGACATCTAATAGG - Exonic
1053815751 9:41905955-41905977 CTTCTCATGGGACATCTAATAGG - Exonic
1054614845 9:67281486-67281508 CTTCTCATGGGACATCTAATAGG + Intergenic
1056274715 9:84982967-84982989 AGTCACATGGGGTATAAATTAGG - Intronic
1057624362 9:96664541-96664563 AGTCACAAGAGGCATATACTGGG + Intergenic
1057710374 9:97436383-97436405 ATTCACATAAGACCTATAATGGG - Intronic
1058886352 9:109324286-109324308 ATTCACACTGGGCATAAAAGAGG - Intergenic
1059847562 9:118297709-118297731 ATTTAGAAGGGGCATATGATAGG + Intergenic
1060214373 9:121729865-121729887 ATTCCTATAGGGCAAATAATTGG + Intronic
1061112871 9:128587769-128587791 AGTCAAATGGGGCCTATGATAGG - Intronic
1185526699 X:785739-785761 ATACACTTGGGGCTTATAACTGG + Intergenic
1187764708 X:22628373-22628395 CTTAACCTGGTGCATATAATAGG + Intergenic
1189646333 X:43136684-43136706 TTTCCTATGGGGAATATAATGGG - Intergenic
1190459342 X:50656450-50656472 ATTCACATGCGGAATGAAATTGG - Intronic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1198425519 X:136516018-136516040 ATTCAGATGTGGGATATATTTGG - Intergenic
1201059809 Y:10035940-10035962 ATGCACATGGGGCATCAGATTGG - Intergenic
1201744635 Y:17358200-17358222 TTTCCCATGTGGCATAAAATGGG + Intergenic
1201856042 Y:18544148-18544170 ATTCACAGGGAACTTATAATTGG + Intergenic
1201877279 Y:18776237-18776259 ATTCACAGGGAACTTATAATTGG - Intronic
1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG + Intergenic